ID: 1131512123

View in Genome Browser
Species Human (GRCh38)
Location 15:93055275-93055297
Sequence GGTCCCACTGCAACACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131512118_1131512123 17 Left 1131512118 15:93055235-93055257 CCAAAGTAGAGGAAAGAACACTG 0: 1
1: 0
2: 2
3: 26
4: 259
Right 1131512123 15:93055275-93055297 GGTCCCACTGCAACACAAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 215
1131512120_1131512123 -6 Left 1131512120 15:93055258-93055280 CCTGTCCCTTTACAGCAGGTCCC 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1131512123 15:93055275-93055297 GGTCCCACTGCAACACAAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131512123 Original CRISPR GGTCCCACTGCAACACAAGC AGG Intronic
902204769 1:14860075-14860097 GGTACCATTGCAACAGTAGCAGG + Intronic
902215127 1:14929984-14930006 GGTGCCACTGCAGCACATGACGG - Intronic
903256896 1:22108551-22108573 GGTCCCACTGTTTTACAAGCTGG - Intergenic
903472417 1:23596494-23596516 GGTACCAGTGCAACCCAGGCTGG + Intronic
903614066 1:24639288-24639310 GGTCACTCTGTAACCCAAGCTGG - Intronic
903623058 1:24712168-24712190 CGTGCCACTGCAACTCCAGCCGG - Intergenic
904738720 1:32655031-32655053 CGTGCCACTGCAACACAGTCTGG - Intronic
907121699 1:52013618-52013640 GGTCCCACTGTCACCCAAGCTGG + Intergenic
907691516 1:56672159-56672181 GGTGCCACTGCAATACAGCCTGG - Intronic
910616148 1:89200225-89200247 GGTCCCACTGCACTCCAACCTGG + Intergenic
913609939 1:120501218-120501240 GGTCAGACTGCAGCACAAGCTGG - Intergenic
913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914203876 1:145509920-145509942 GGTCAGACTGCAGCACAAGCTGG + Intergenic
914482999 1:148083074-148083096 GGTCAGACTGAAGCACAAGCTGG + Intergenic
914581250 1:149021023-149021045 GGTCAGACTGCAGCACAAGCTGG + Exonic
914622070 1:149419755-149419777 TGTCCCACATCAACACAACCTGG - Intergenic
914996486 1:152547168-152547190 GATCCAGCTGCAGCACAAGCAGG - Intronic
919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG + Intergenic
919575433 1:199303112-199303134 GATCTCACTGCCACACAGGCTGG + Intergenic
921564465 1:216699714-216699736 GTTCAAACTGCAACAAAAGCTGG + Intronic
921736822 1:218637987-218638009 GGTTCTACTGCAACTCAAGTTGG - Intergenic
922913184 1:229234399-229234421 TCACCCACTGCAGCACAAGCTGG + Intergenic
922941044 1:229466303-229466325 GGTCTCACTGTCACCCAAGCTGG - Intronic
923087896 1:230715040-230715062 GATCCTGCTTCAACACAAGCAGG + Intergenic
1063538612 10:6909940-6909962 GTTCCCACTGCACCACTTGCAGG - Intergenic
1064173035 10:13050814-13050836 GGTCTCACTGTAACCCAGGCTGG + Intronic
1064267216 10:13834739-13834761 TGTCCCATGGCAACACAGGCTGG - Intronic
1067294230 10:44965661-44965683 GGGCCCACTGCAGCAAAAGGAGG - Intronic
1067476515 10:46570945-46570967 GGCACCACTGCAACAAAAGAAGG + Intergenic
1067618223 10:47770836-47770858 GGCACCACTGCAACAAAAGAAGG - Intergenic
1069861450 10:71474175-71474197 GGACCCTCTGCAGAACAAGCTGG - Intronic
1069894281 10:71670987-71671009 GGTCTCACTGTCACACAGGCTGG + Intronic
1070285806 10:75082910-75082932 GGTCTCACTGCTACCCAGGCTGG - Intergenic
1071565336 10:86668687-86668709 GGTCACACTGTAAGACATGCTGG - Exonic
1071663577 10:87530825-87530847 GAGCCCACTGCAACTCAAGGAGG - Intronic
1074542047 10:114373211-114373233 GGTCTCACTGCCACACAGGCTGG - Intronic
1075251358 10:120877587-120877609 GGTCTCACTGTCACCCAAGCTGG - Intronic
1078339159 11:10486687-10486709 GGTTCCTCTGCAACCCAAGGTGG + Intronic
1081087653 11:38821885-38821907 GAGCCCACTGCAACTCAAGGAGG - Intergenic
1084032568 11:66489491-66489513 GATCTCACTGGAACATAAGCTGG + Intronic
1084138740 11:67208739-67208761 GGTCTCACTGTCACACAGGCTGG - Intronic
1084164332 11:67367986-67368008 GGTACAACTGGAACACAGGCAGG - Intronic
1084399469 11:68935283-68935305 GGTCCACCTGAAACACCAGCCGG - Exonic
1084714357 11:70864188-70864210 GTTGCCACGGCAACAGAAGCTGG - Intronic
1086372627 11:86170095-86170117 GGTCTCTCTGCAAAATAAGCAGG - Intergenic
1086762028 11:90643373-90643395 GGTCCAAGTGCAAAAGAAGCTGG - Intergenic
1089030714 11:115325395-115325417 GGTCAAACTGCAATAAAAGCAGG + Intronic
1092868300 12:12783675-12783697 GGTACCACTGCAACACAGCCTGG - Intronic
1093060780 12:14601062-14601084 TGTGCCACTGCAACACAGTCTGG - Intergenic
1095291313 12:40483165-40483187 GGTACAACTGGAACACCAGCTGG + Exonic
1095726877 12:45463593-45463615 GGTCCTACTGCATCACAATTGGG + Intergenic
1097146729 12:56945855-56945877 GGTCCCAATGCAATAATAGCTGG - Intergenic
1098692263 12:73503653-73503675 GAGCCCACTGCAGCACAAGGAGG - Intergenic
1099391492 12:82086034-82086056 GGTCCCACAGCCAGACAAGCAGG - Intergenic
1100456474 12:94756444-94756466 GGTCTCACTGTAACCCAGGCTGG - Intergenic
1101407173 12:104438899-104438921 GGCCCCGCTCCAACCCAAGCAGG + Intergenic
1103359354 12:120344675-120344697 GGTCTCACTGCCACCCAGGCTGG - Intronic
1109586535 13:64411732-64411754 CGTCCCACTGCACTCCAAGCTGG + Intergenic
1111091224 13:83450733-83450755 TGTCCCACTGCACTACAACCTGG - Intergenic
1111244525 13:85518341-85518363 GGTCCCACTGCACTCCAACCTGG + Intergenic
1111427396 13:88104856-88104878 GGTCCTACTGAAAAAGAAGCTGG + Intergenic
1115135880 14:30107445-30107467 GCTCCCACTGCAGCTCAAGGAGG + Intronic
1117061866 14:51971904-51971926 GGTCCCACTTCAAGCCCAGCTGG + Intronic
1118814722 14:69301947-69301969 GGTCTCACTGTCACCCAAGCTGG - Intronic
1119879959 14:78092181-78092203 GGCCCCACACCAAAACAAGCAGG - Intergenic
1122969026 14:105144968-105144990 GGTCGCAAAGCAACACCAGCAGG + Exonic
1124561270 15:30775661-30775683 GATCCCACTGCAGCTCAAGGAGG + Intergenic
1124788054 15:32700164-32700186 GGTCCCACAGGAACACAAAAAGG - Intergenic
1125650689 15:41315070-41315092 GGTCTCACTGTCACACAGGCTGG - Intronic
1125802515 15:42462811-42462833 GGTCTCACTGCCACCCAGGCTGG + Intronic
1126356637 15:47802930-47802952 GGTCTCACAGCAACTCAAGGAGG - Intergenic
1127201901 15:56663252-56663274 GGTCTCACTCCAACCCAGGCTGG - Intronic
1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG + Intergenic
1128464320 15:67896822-67896844 GGTGCCACTGCACTCCAAGCTGG + Intergenic
1128583500 15:68826489-68826511 GGTCTCACTGCCACCCAGGCTGG + Intronic
1131512123 15:93055275-93055297 GGTCCCACTGCAACACAAGCAGG + Intronic
1132622885 16:876001-876023 GGTCCCACTGCCACCCAGGGAGG - Intronic
1133329679 16:4964758-4964780 GGTCTCACTGTCACCCAAGCTGG + Intronic
1134198743 16:12180348-12180370 TGACCTACTGCAAAACAAGCTGG - Intronic
1135380473 16:21992205-21992227 GGTCTCACTGTCACACAGGCTGG - Intronic
1137014118 16:35357086-35357108 GGTCTCACTGTCACACAGGCTGG + Intergenic
1139453558 16:67052530-67052552 GGTGCCACTGCAATCCAACCTGG + Intronic
1139590178 16:67928985-67929007 GGTCCCACTGAGCCTCAAGCTGG + Exonic
1139924839 16:70480358-70480380 GGGCCCCCAGCACCACAAGCTGG - Intergenic
1140047049 16:71447125-71447147 GGTCTCACTGCCACCCAGGCTGG + Intergenic
1140520907 16:75580919-75580941 GGTCTCACTGTCACACAGGCTGG + Intergenic
1141664318 16:85458119-85458141 GGCCCCTCTGCAGCACCAGCCGG + Intergenic
1143190578 17:5037117-5037139 GGTCTCACTGTCACCCAAGCTGG - Intronic
1145983165 17:29026329-29026351 GGTCCCACTGTCACCCAGGCTGG + Intronic
1146095422 17:29925677-29925699 GGTCTCACTGTAGCACAGGCTGG - Intronic
1147163186 17:38579414-38579436 GGTCCCACTGCCCCAGACGCTGG - Intronic
1147878751 17:43640633-43640655 CCTCCCTCTGCAACACCAGCTGG + Exonic
1149692015 17:58585469-58585491 GGTCTCACTGTCACCCAAGCTGG + Intronic
1149790696 17:59474492-59474514 GGTCTCACTGTAACCCAGGCTGG + Intergenic
1150956738 17:69868033-69868055 GGTGCCACTGCAATCCAACCTGG + Intergenic
1151143352 17:72016412-72016434 GTTCTCACTGCAATAGAAGCTGG - Intergenic
1151354128 17:73548547-73548569 GGTCCAACTGGCACAGAAGCTGG + Intronic
1155094532 18:22543195-22543217 TGTGCCACTGCAACCCAGGCTGG + Intergenic
1155505941 18:26532735-26532757 GGTCCCACCCCCACAGAAGCAGG - Intronic
1156348298 18:36279283-36279305 GGTACCACTGCACCAGAGGCTGG + Intergenic
1156399541 18:36728118-36728140 GGACCCTCTGCAACTGAAGCTGG - Intronic
1158862666 18:61607807-61607829 GGACCCACTGTAACAAAAGATGG - Intergenic
1160154534 18:76423631-76423653 GGTCCCCCCGAAACACACGCAGG + Intronic
1160371546 18:78376286-78376308 GCTCCCACTGCAACCAGAGCTGG + Intergenic
1161551100 19:4912801-4912823 CGTGCCACTGCAACACAGCCTGG - Intronic
1164495537 19:28757350-28757372 GAGCCCACTGCAACTCAAGGAGG + Intergenic
1164763874 19:30748132-30748154 GGTCCATCTGCATCACAGGCTGG + Intergenic
1165596739 19:37015642-37015664 GGTCCCACAACTACACCAGCAGG + Intronic
1166035954 19:40168731-40168753 GGTCTCACTGCCACACAGGCTGG - Intergenic
1166845808 19:45727617-45727639 GGTCACACAGCAACAGAAGCAGG + Intronic
1167351515 19:48977996-48978018 GCTCCCACTGCAAGGCAAGCAGG + Exonic
1168667530 19:58215681-58215703 GGTCTCACTCCCACACAGGCTGG - Intergenic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
927921146 2:26972530-26972552 GTTCCCACTGCACCACAGGCAGG - Intronic
928863717 2:35892765-35892787 GATCCCAGTGCAATACTAGCTGG - Intergenic
929988420 2:46761957-46761979 CCTCCCACTGCATCAGAAGCAGG + Exonic
930774851 2:55161539-55161561 GGTTCCCCTTCAAGACAAGCAGG + Intergenic
931698754 2:64891523-64891545 GATCCCACTGCAGCTCAAGGAGG + Intergenic
932691830 2:73920195-73920217 CGTACCACTGCACCACAACCTGG - Intergenic
933122525 2:78558555-78558577 GGTGCCACTGCAATACAATAGGG + Intergenic
936158598 2:110067010-110067032 GGTCTCACTGCCACCCAGGCTGG + Intergenic
936186062 2:110304313-110304335 GGTCTCACTGCCACCCAGGCTGG - Intergenic
942051233 2:172142907-172142929 GGTCCCACTGTCACTCAGGCTGG + Intergenic
942477151 2:176339475-176339497 GGTCTCACTGTCACCCAAGCTGG + Intergenic
944724257 2:202454097-202454119 GGTCTCACTGTCACCCAAGCTGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946327080 2:218990341-218990363 GGTCCCGCTCCAACACATACTGG + Exonic
947106152 2:226669876-226669898 AGTCCCACTGTAACCCCAGCTGG - Intergenic
947446668 2:230169350-230169372 GGTGCCACTGCACCACAGCCTGG - Intronic
948152931 2:235758820-235758842 TGTCTCACTGTCACACAAGCTGG + Intronic
948171874 2:235910274-235910296 CGCCCCCCTGCAACACAGGCAGG - Intronic
948222094 2:236278567-236278589 GGTCACACTGCAACCCAGGTAGG - Intergenic
1169258206 20:4115145-4115167 CGTGCCACTGCAATCCAAGCTGG - Intergenic
1172196036 20:33092278-33092300 GGTTCCACTGCATCATAAACTGG + Intronic
1172456904 20:35083564-35083586 GGTGCCACTGCACTACAATCTGG + Intronic
1173867351 20:46321135-46321157 GGGCCCCCTGCAACTCAAGCTGG + Intergenic
1174848847 20:53971460-53971482 GTTGTCACTGCAACACAACCTGG + Intronic
1176067600 20:63206650-63206672 GGTTCCACGGCCACACAGGCAGG + Intronic
1178296397 21:31413884-31413906 AGTCCCCCCGCAACACGAGCTGG + Intronic
1181104053 22:20561959-20561981 GGTCTCACTGCAGCCCAGGCTGG - Intronic
1184477305 22:44728710-44728732 GCTCCCAGTGGAACCCAAGCAGG - Intronic
1184976248 22:48064445-48064467 GGACCCAGAGCAGCACAAGCTGG + Intergenic
951089370 3:18554370-18554392 GGTCCCACTGTTACACATGAGGG + Intergenic
952368489 3:32696626-32696648 GGTCTCACTGTCACCCAAGCTGG + Intronic
952411862 3:33056455-33056477 TGTGCCACTGCACCCCAAGCTGG - Intronic
952929154 3:38346502-38346524 GCTCCCTCTGAAAGACAAGCCGG + Intergenic
954128610 3:48548049-48548071 GGTCACCCTGCAACAGAAGCTGG - Intronic
954808707 3:53235014-53235036 GGCCCCACTGCAGCACCAGATGG - Exonic
955684927 3:61539976-61539998 GGTGCCACTGCACCACAACTTGG + Intergenic
958141435 3:89567514-89567536 GGTCCCAATGCAACAATAGCTGG + Intergenic
960108832 3:113825848-113825870 GGTGCCACTGCAACCCAGCCTGG + Intergenic
960622292 3:119648433-119648455 GGTCCCACTGCTGCAGATGCTGG - Exonic
961196769 3:125008751-125008773 GGTGCCACTGCACCACAGCCTGG + Intronic
962807031 3:138935106-138935128 GGTGCCACTGCACTCCAAGCTGG + Intergenic
963032046 3:140988075-140988097 GGGCCCACTGCAGCTCAAGGAGG + Intergenic
963311613 3:143716116-143716138 GGTGCCACTGCAATCCAACCTGG - Intronic
965041248 3:163509749-163509771 GGTCCCACTGTATTACAACCTGG - Intergenic
968163651 3:196447229-196447251 GGTCTCACTGCCACCCAGGCTGG - Intergenic
968314858 3:197715243-197715265 CGTGCCACTGCAACACAGCCTGG + Intronic
968331675 3:197875622-197875644 GGTCTCACTGCCACCCAGGCTGG - Intronic
969850175 4:9949889-9949911 GGCCCCACTGCTAAACAAGCAGG - Intronic
970797098 4:19926022-19926044 GGTGCCCCTACAACAAAAGCTGG + Intergenic
971178404 4:24304190-24304212 TGCCCCATTGCCACACAAGCAGG - Intergenic
974287826 4:59892467-59892489 GAGCCCACTGCAGCTCAAGCAGG + Intergenic
974930058 4:68351167-68351189 GGTCTCACTGTGACACAGGCTGG + Intergenic
979413697 4:120409667-120409689 GGTCCCAATGCAATAATAGCTGG + Intergenic
982179682 4:152738274-152738296 GGTACCACTGCACCATAGGCAGG - Intronic
982992552 4:162296888-162296910 GGTTCCACTTCAACACATTCTGG + Intergenic
988609607 5:32712208-32712230 GGTCCCAGTGCGATGCAAGCCGG - Exonic
989350472 5:40480119-40480141 GTTTCCACTTCAACACAAGCTGG - Intergenic
990360425 5:55013358-55013380 GATCCCACTGCAGCTCAAGGAGG + Intronic
995107270 5:108388936-108388958 GGTGCCACTGCACTCCAAGCTGG - Intergenic
998249982 5:140545989-140546011 GGTCTCACTGTCACCCAAGCTGG - Intronic
998366445 5:141635800-141635822 GGTCCCACTGTGGCCCAAGCTGG + Intronic
1000384743 5:160664183-160664205 GGTCCCAGTGCAAATCTAGCAGG + Intronic
1001045636 5:168369444-168369466 GGCACCACTGCATTACAAGCTGG - Intronic
1002622083 5:180494878-180494900 GGTCCCGCTGCTCCGCAAGCTGG + Intronic
1003584075 6:7370321-7370343 GGTCTCACTGTCACACAGGCTGG + Intronic
1004730440 6:18353017-18353039 GGTCCTACTCCCAGACAAGCAGG + Intergenic
1006857690 6:37146976-37146998 GGTGCCACTGCAACAAAGCCTGG - Intergenic
1007375354 6:41452527-41452549 GGTCCCACTGCACCACCTGTGGG + Intergenic
1008630064 6:53356107-53356129 GGTGCCACTGCACCACAGCCTGG - Intergenic
1010825041 6:80462889-80462911 GCTCCCAGTGCATCACAATCTGG - Intergenic
1013934452 6:115576863-115576885 TTTCTCACTGCAACATAAGCTGG - Intergenic
1016813078 6:148279955-148279977 GGTCTCACTGCCACCCAGGCTGG - Intronic
1016896501 6:149059264-149059286 GCTCCCACATCAACAGAAGCTGG + Intronic
1017652250 6:156594424-156594446 GGTCTCACTGTCACCCAAGCTGG + Intergenic
1019534267 7:1520368-1520390 GGTCCAACTGGAACAGAAGGTGG + Intergenic
1019808736 7:3148706-3148728 GGTCTCACTGTCACACAGGCTGG + Intronic
1020096634 7:5373278-5373300 TGTACCACTGCAGTACAAGCTGG + Intronic
1022015079 7:26342834-26342856 GGTCTCACTGTAACCCAGGCTGG + Intronic
1023103552 7:36742514-36742536 GGTCCCACTGTCACCCACGCTGG - Intergenic
1025868438 7:65407428-65407450 GGGCCCACTGCAACTCAAGGAGG - Intergenic
1026642933 7:72142490-72142512 GATCCCACTGCAGCTCAAGGAGG + Intronic
1032010668 7:128345280-128345302 GGTGCCACTGCACCCCAAGTTGG - Intergenic
1034436547 7:151065286-151065308 GCTCCCACTACACCACAGGCAGG - Intronic
1037025103 8:14025760-14025782 GGTCTCACTGTTACCCAAGCAGG + Intergenic
1039154582 8:34540737-34540759 GGGCCCACTGCAGCTCAAGGAGG + Intergenic
1041141106 8:54820284-54820306 CAACCCAGTGCAACACAAGCTGG - Intergenic
1041683602 8:60620707-60620729 GCTACCAATGCAACACATGCAGG + Exonic
1043554218 8:81411516-81411538 GGCCCCACTGCAATAAGAGCTGG + Intergenic
1044042317 8:87385636-87385658 GGGCCCACCGCAGCACAAGGAGG + Intronic
1044614791 8:94128852-94128874 GGTCCCACAACAACATAGGCAGG - Intronic
1045207708 8:100059672-100059694 GGTCCCAATGCAACAATAGCTGG + Intronic
1047010426 8:120667138-120667160 GGTCCCACTGCAGCAAAGCCTGG - Intronic
1047141887 8:122150637-122150659 ATTCCCACTGCATCATAAGCAGG - Intergenic
1047316129 8:123734954-123734976 GGTCCCACGGCATTACAAGGAGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049612273 8:143561178-143561200 GGGCCCACGGCAGCCCAAGCTGG - Intronic
1049614585 8:143570549-143570571 GGTCACACAGCTGCACAAGCTGG - Exonic
1051104958 9:13568997-13569019 AGTCCCACTTCGACACAACCAGG - Intergenic
1052766599 9:32647788-32647810 AGTGTCACTGCTACACAAGCTGG - Intergenic
1053240747 9:36492774-36492796 CGTGCCACTGCACCACAACCTGG + Intergenic
1053462738 9:38283022-38283044 GGTCCCACTGAAACAGAAGAGGG + Intergenic
1053555748 9:39135314-39135336 GGTGCCACTGCACTCCAAGCTGG - Intronic
1053819867 9:41955572-41955594 GGTGCCACTGCACTCCAAGCTGG - Intronic
1054110133 9:61099231-61099253 GGTGCCACTGCACTCCAAGCTGG - Intergenic
1054610724 9:67231894-67231916 GGTGCCACTGCACTCCAAGCTGG + Intergenic
1056403545 9:86252076-86252098 GGTGCCACTGCACCACAGCCTGG - Intronic
1057506739 9:95640242-95640264 GTTCCCACTCCAACAACAGCTGG - Intergenic
1057561184 9:96129162-96129184 CCTCCCACTGCATCACAAGCTGG - Intergenic
1059565130 9:115376775-115376797 GAGCCCAGTGCAAAACAAGCAGG + Intronic
1061035408 9:128111260-128111282 AGTAGCACTGCAACACATGCAGG - Intergenic
1062668263 9:137690477-137690499 GGTCTCACTGCCACCCAGGCGGG - Intronic
1062703262 9:137919202-137919224 GGTCCTACTGAAACACATGCTGG - Intronic
1186398370 X:9233597-9233619 GTTGCCACAGCAACACAAGTTGG - Intergenic
1186982732 X:14974623-14974645 GAGCCCACTGCAACTCAAGTAGG - Intergenic
1188747519 X:33864233-33864255 CGTCCCACTGCACCACAGCCTGG + Intergenic
1190128515 X:47725782-47725804 GGTCCCACAGTTGCACAAGCTGG + Intergenic
1191592835 X:62906597-62906619 GATCCCACTGCAGCTCAAGGAGG - Intergenic
1191656844 X:63607528-63607550 GAGCCCACTGCAACTCAAGGAGG + Intergenic
1193011007 X:76674905-76674927 GAGCCCACTGCAACTCAAGGAGG + Intergenic
1197678051 X:129352322-129352344 GGGCCCACTGCAGCTCAAGGAGG + Intergenic
1197788481 X:130224800-130224822 CCTCCCACTGCAAGAAAAGCAGG + Intronic
1198461303 X:136865419-136865441 GGTCTCACTGTCACCCAAGCTGG + Intronic
1198489326 X:137122923-137122945 GAGCCCACTGCAACTCAAGGAGG + Intergenic
1199075572 X:143521525-143521547 GGTCTCACTGCCACCCAGGCTGG - Intergenic
1200785294 Y:7255533-7255555 GGTCTCACTGTCACACAGGCTGG + Intergenic