ID: 1131512758

View in Genome Browser
Species Human (GRCh38)
Location 15:93058416-93058438
Sequence GGCACTGATGTGAGCAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131512756_1131512758 2 Left 1131512756 15:93058391-93058413 CCAGAGGGGTGTTAAAGGGACTG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1131512758 15:93058416-93058438 GGCACTGATGTGAGCAAAGCCGG 0: 1
1: 0
2: 2
3: 19
4: 217
1131512753_1131512758 7 Left 1131512753 15:93058386-93058408 CCTCACCAGAGGGGTGTTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1131512758 15:93058416-93058438 GGCACTGATGTGAGCAAAGCCGG 0: 1
1: 0
2: 2
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131512758 Original CRISPR GGCACTGATGTGAGCAAAGC CGG Intronic
901768550 1:11519060-11519082 GGCACTAAGGTGATCAAATCAGG - Intronic
902219643 1:14956942-14956964 GGAAATGGTGTGAGCAAAGGCGG - Intronic
905510992 1:38519949-38519971 GGCACTGAAGTGTGTCAAGCAGG + Intergenic
905603086 1:39270768-39270790 GGCCCTGATGTTTGCAGAGCAGG + Intronic
907528129 1:55065990-55066012 GGGACCCATGTGAGCAACGCTGG + Intergenic
909029644 1:70524185-70524207 GGCACTGGTGGGAGCAAGCCAGG + Intergenic
909957131 1:81792106-81792128 AGCACTGAATTGAGGAAAGCAGG + Intronic
911421500 1:97646942-97646964 GGAACTGAGATGAGCAATGCTGG - Intronic
913554425 1:119950755-119950777 GCCACTTATGTCATCAAAGCAGG + Exonic
916081165 1:161233294-161233316 GGCATTGCGGCGAGCAAAGCAGG - Exonic
920182899 1:204143482-204143504 GGGACTGAAGGTAGCAAAGCTGG - Intronic
921784183 1:219207606-219207628 GGCACTGTTGTAAGCATAGAGGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922786003 1:228282565-228282587 GGCGGTGATGTCAGCAGAGCAGG - Intronic
922796001 1:228340197-228340219 GGCTCTGATGTGGGCAGAACAGG - Intronic
923712739 1:236400024-236400046 AGCACTCATATGTGCAAAGCTGG + Intronic
1063147145 10:3305900-3305922 AGCACTCATGTGAGCAACCCTGG - Intergenic
1063460930 10:6214721-6214743 GGCACTGAGCTGGGCACAGCGGG - Intronic
1064011918 10:11742485-11742507 GGCGCTGCTGTGAGCAGGGCCGG - Exonic
1064541119 10:16406104-16406126 GGCGGTAATGTGAGCAATGCGGG - Intergenic
1068121497 10:52785832-52785854 GGGAGTGATCTGAGGAAAGCTGG - Intergenic
1069904952 10:71726747-71726769 GTGACTGATGTCAGCGAAGCTGG + Intronic
1072155094 10:92716711-92716733 GGCACTGATGTTAGCAGACCTGG - Intergenic
1072309027 10:94136703-94136725 GGCACTGAAGGCAGAAAAGCAGG - Intronic
1074145025 10:110710013-110710035 AACGCTGATGTGAGCAAAGCTGG - Intronic
1076992989 11:285211-285233 GGCTGTGAAGAGAGCAAAGCCGG + Exonic
1077110815 11:861284-861306 GGCACTGGTGGGAACAAAGCAGG - Intronic
1077517287 11:3009636-3009658 GGCACTGAAGTGAGAAAGCCAGG - Intronic
1077765201 11:5151620-5151642 GACACAGATGTGAGCAATGCAGG + Exonic
1079027243 11:16959263-16959285 GGAACTCATGAGAGCAAAGAAGG - Intronic
1082100546 11:48169636-48169658 GGCAGTGATGTGGGCAGAGCAGG - Intronic
1085460479 11:76690177-76690199 GGGACTGATGTGAACAGGGCAGG - Intergenic
1087013355 11:93533647-93533669 GGCTCTGATGTGCACAAAGGAGG + Intronic
1087675207 11:101153724-101153746 GGAACTGCTATGAGCAAGGCTGG - Intergenic
1087921668 11:103874078-103874100 GGCAGTGATGTCAGAAAAACAGG - Intergenic
1088688626 11:112305709-112305731 GGCACTGATGTGACCAGATCTGG + Intergenic
1090134785 11:124185988-124186010 GGCAATGAGGTGAGCACTGCAGG - Exonic
1090502846 11:127278572-127278594 GGAACTGATGTGAGATAAGGAGG + Intergenic
1090834335 11:130443084-130443106 GCCACAGAGGTGGGCAAAGCAGG - Intergenic
1091013390 11:132026815-132026837 GGGACTGGTTTGAACAAAGCAGG + Intronic
1091710750 12:2738326-2738348 GGCACTGAGCTGAGCACAGATGG + Intergenic
1092831607 12:12449402-12449424 GGCATTGATGGCAGCAAACCAGG - Intronic
1093146203 12:15569723-15569745 GGTACTGAGGTGAGCAAACATGG + Intronic
1094274302 12:28653932-28653954 TGCACTGCTGTGATCATAGCTGG - Intergenic
1095128086 12:38505926-38505948 GGAAGTGGTGTGAGAAAAGCAGG - Intergenic
1096670478 12:53195644-53195666 GGCACTGGTGACAGCAAAGATGG + Exonic
1104783972 12:131438013-131438035 GGCAGGGCTGTGAGGAAAGCAGG - Intergenic
1111931184 13:94514654-94514676 GGCAGGGATGTGAGAAAGGCTGG + Intergenic
1114958249 14:27849695-27849717 GGCACTGATGTGATGCCAGCAGG - Intergenic
1115660839 14:35493083-35493105 GGCAGTGATGTCAGCAAAAATGG - Intergenic
1118611943 14:67548073-67548095 GAAAATGATGTGAGCAAAGCAGG - Intronic
1120982069 14:90298997-90299019 GGCACAGATCTGAACAAGGCAGG + Intronic
1121332111 14:93056151-93056173 GAGACTGGTGTGTGCAAAGCAGG + Intronic
1121559374 14:94863324-94863346 GGCACTCAAGTGAGCAAGGCTGG - Intergenic
1121693798 14:95896262-95896284 GGCACTGGAGTGAGCCAGGCAGG + Intergenic
1121806266 14:96826990-96827012 GACACAGATGTCAGGAAAGCTGG + Intronic
1122015902 14:98796389-98796411 GGCACTAATGTGTGCTAAGAAGG - Intergenic
1122129630 14:99597579-99597601 GGCACTGAAGTCTGAAAAGCTGG + Intronic
1123704587 15:22941731-22941753 GGGGCTGCTGTGTGCAAAGCTGG - Intronic
1126007841 15:44275329-44275351 GACACAGCTGTGAGCAGAGCTGG - Intergenic
1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG + Exonic
1128518428 15:68358881-68358903 GGTACTGATTTGAGCAGTGCTGG - Intronic
1129623025 15:77166824-77166846 GACACTAATGTGACAAAAGCAGG + Intronic
1131512758 15:93058416-93058438 GGCACTGATGTGAGCAAAGCCGG + Intronic
1132366897 15:101264372-101264394 GGCACTGATGGGAAAGAAGCGGG + Intergenic
1132681437 16:1144082-1144104 GGCTGTGATGTGTGCAAGGCCGG - Intergenic
1133378230 16:5307278-5307300 GGCACTCAGGTGTGCAAACCTGG + Intergenic
1134343597 16:13368265-13368287 GGCAGTGAGGTGAGAAAAGGGGG + Intergenic
1135381194 16:21997493-21997515 GGCTCCGAAGTGAGTAAAGCTGG + Intronic
1137302165 16:47161640-47161662 GGCACTCATGGGAACACAGCAGG + Intronic
1138051552 16:53783846-53783868 GGCAGTTAAATGAGCAAAGCAGG - Intronic
1138650776 16:58459939-58459961 GGCAAAGCTGTAAGCAAAGCTGG - Intergenic
1141159902 16:81622282-81622304 GGCATAGATGTCAGCCAAGCAGG + Intronic
1141247047 16:82317598-82317620 TGCACTGATGAGAACACAGCAGG - Intergenic
1141635319 16:85311226-85311248 GGCACTGATGTGGGCACAAAGGG + Intergenic
1141717519 16:85735316-85735338 GGCCCTGATGAGTGCAAAACAGG + Intronic
1141838215 16:86556751-86556773 GGCTCTGTTTTGAGCACAGCTGG - Intergenic
1141927148 16:87177361-87177383 GGCACTGCCGTGAGCAGGGCAGG - Intronic
1142898087 17:2995182-2995204 GGCTGTGATGTGGGAAAAGCAGG - Intronic
1143136802 17:4716676-4716698 GGCACTGCTGTGGGCAGATCTGG + Intronic
1143433974 17:6909027-6909049 GGCACTGTTGGTAGCAGAGCTGG + Intronic
1146271163 17:31486934-31486956 GGCAGAGAAGTGGGCAAAGCTGG + Intronic
1148137735 17:45305792-45305814 GGAACAGATGTGGTCAAAGCAGG + Intronic
1150555179 17:66247956-66247978 GGCACAGTTGTGAACACAGCAGG + Intronic
1150700069 17:67438897-67438919 GAAACGGATGGGAGCAAAGCAGG - Intronic
1150799990 17:68273605-68273627 GACACTGATGTGAGAAATACTGG + Intronic
1151939096 17:77281598-77281620 GGCACTCAGGTGAGCAGCGCTGG - Intronic
1153632096 18:7080408-7080430 GGTGCTGATGTGAGCATTGCTGG + Exonic
1154077942 18:11223731-11223753 GGCAGTGATGTCAGAGAAGCTGG + Intergenic
1155154741 18:23148823-23148845 GGCACAGGTGTGAGCAGAGCTGG + Intronic
1156027182 18:32668681-32668703 AGCACTGCTGTGAGCAAACATGG + Intergenic
1158047079 18:53169183-53169205 GGGACTGATCTCAGTAAAGCAGG + Intronic
1158563272 18:58533116-58533138 GCCACTGGTCTGAGCAAAGCAGG - Intronic
1160406633 18:78651115-78651137 GGCACTGATCTGAGGAGAACAGG - Intergenic
1160468530 18:79104333-79104355 GGCACTGATGGGTGCAGTGCTGG + Intronic
1161361176 19:3850555-3850577 GGGACTGATCTGAGCAGAACTGG + Intronic
1166212546 19:41316405-41316427 GGCACTGGGGTGAGCTGAGCCGG + Exonic
1167528005 19:49997371-49997393 GACACAGATGGGAGCAAACCTGG + Intronic
1167853452 19:52219672-52219694 GGCACTGAGGAGAGGAAAGAAGG - Exonic
926740532 2:16106838-16106860 GACACGGAGGTGAGAAAAGCAGG - Intergenic
927026452 2:19073582-19073604 GGCAGTGATGTCAGCAAGGGTGG - Intergenic
927506674 2:23619499-23619521 GACACTGATGTGAGGAAATTAGG + Intronic
928977092 2:37099340-37099362 TGCACTGCTGTGAAGAAAGCAGG - Exonic
934576508 2:95405104-95405126 GGAAGTGATGTGAGCTGAGCTGG - Intronic
934638733 2:96013273-96013295 GGAAGTGATGTGAGCTGAGCTGG - Intergenic
934794918 2:97092139-97092161 GGAAGTGATGTGAGCTGAGCTGG + Intronic
934854851 2:97723348-97723370 GGCCCTTGGGTGAGCAAAGCTGG + Intronic
937381059 2:121376731-121376753 GGCAGTAATGTGAGCAATGTGGG - Intronic
938307232 2:130264482-130264504 GGCCTTGATGTGAGTCAAGCTGG - Intergenic
940227968 2:151420226-151420248 GGCAGTGAGGTGGGCAAAACTGG + Exonic
942514567 2:176738224-176738246 TGTACGGATGTGAGGAAAGCAGG - Intergenic
943111244 2:183608739-183608761 GGCACAGATGTTAGGAAGGCTGG + Intergenic
945086305 2:206135967-206135989 TGCACTGACGACAGCAAAGCAGG + Intronic
947747440 2:232516139-232516161 CGCACTGTAGTCAGCAAAGCTGG + Intergenic
948807216 2:240458233-240458255 GGCCCTGAGGTGTGCACAGCAGG + Intronic
949061094 2:241957823-241957845 GGCAGAGATGGGAGCAATGCAGG - Intergenic
1170449444 20:16467098-16467120 GGCTCTGATGTAATCCAAGCAGG - Intronic
1170457144 20:16543938-16543960 AGAACTGCTGAGAGCAAAGCTGG + Intronic
1170513821 20:17107086-17107108 GGCACACATCTGAGAAAAGCAGG - Intergenic
1172621643 20:36321428-36321450 AGGTCTGATGTGAGCATAGCTGG + Intronic
1172670822 20:36633447-36633469 GGCTCTGCGCTGAGCAAAGCTGG - Intronic
1173202215 20:40962418-40962440 GGCCCAGGTGGGAGCAAAGCTGG - Intergenic
1174053163 20:47781265-47781287 GCCACTAATGTGAGCAATGCTGG - Intronic
1174103578 20:48146181-48146203 AGGACTGAGGTGAGAAAAGCAGG + Intergenic
1174201800 20:48811435-48811457 GCCACAGATGTGATGAAAGCAGG - Intronic
1174519446 20:51118416-51118438 GGCACTGACCTAAGCAAAGCAGG - Intergenic
1174908178 20:54574510-54574532 GGCACTGATGTGAGCTAAACAGG + Intronic
1175790633 20:61738026-61738048 GGCTCTGGTGTGAGGACAGCAGG + Intronic
1175894707 20:62330941-62330963 GGCACTGGTGAGAGCACAGTGGG + Exonic
1176083610 20:63285988-63286010 GGGACTGATGGCAGCAAAGACGG - Intronic
1176944036 21:14956972-14956994 GGCACTGATGCCAAGAAAGCAGG + Intergenic
1180012532 21:45060256-45060278 GGCACTGGTGTGTGCGAGGCAGG + Intergenic
1182049803 22:27303972-27303994 GGCACTGATGTGGGACAAGATGG + Intergenic
1182597749 22:31435244-31435266 GCAACTGGTGTGATCAAAGCAGG + Intronic
1183271821 22:36867057-36867079 GGTACAGCTGTGAGCCAAGCAGG + Intronic
1184050638 22:42001523-42001545 GCAGCTGATGTGGGCAAAGCTGG - Intronic
1184138215 22:42561913-42561935 GGCACAGAAGTGAGCTAATCTGG + Intronic
1185313456 22:50169278-50169300 GCCACTGCTGTGAGCAAACCAGG - Intergenic
1185387076 22:50538612-50538634 AGTCCTGATGTGAGCACAGCAGG + Intergenic
949089677 3:12139-12161 AGAACTAATGTCAGCAAAGCAGG + Intergenic
949543758 3:5054614-5054636 GGTACAAAGGTGAGCAAAGCTGG + Intergenic
949868987 3:8570897-8570919 GGTACAGAGGTGAGGAAAGCAGG - Intergenic
950656865 3:14441900-14441922 GACACAGTTGTGAGCAAGGCAGG + Intronic
951723616 3:25729741-25729763 GTCACTGAAGTGAGTTAAGCAGG - Intronic
953519053 3:43623581-43623603 GGCATTGATCTGGCCAAAGCTGG - Intronic
953837075 3:46356063-46356085 GGCACTGAAGTGAGCAAAGTGGG - Intronic
954050297 3:47970001-47970023 GTCACTGCTGTGGGCAAAGTGGG - Intronic
954886526 3:53880005-53880027 GGCAATGACGTGAGGAATGCTGG + Exonic
955919105 3:63936315-63936337 GTCACTGATGTTAGCACAGATGG - Intronic
957029357 3:75221858-75221880 AGAACTAATGTCAGCAAAGCAGG + Intergenic
957566202 3:81887352-81887374 GGCAATTATGTGAGCAATGGTGG - Intergenic
958923127 3:100128144-100128166 GTCACAGATGTGAGAAAGGCTGG - Intronic
959181592 3:102987314-102987336 TGCACTGATTTGAGCAAAAAAGG - Intergenic
960233222 3:115253339-115253361 GGCGCTGAGGTGAGGAAAGAGGG + Intergenic
961355654 3:126338283-126338305 GGCACTGCTGGGAGGACAGCTGG - Intergenic
962171327 3:133104607-133104629 GGCCCTGCTGTGTGCACAGCTGG + Intronic
962815831 3:138998356-138998378 GGCATTTATCTGAGCAATGCAGG - Intergenic
964062130 3:152537598-152537620 GGCACTGGTGGGAGCGATGCTGG + Intergenic
966667618 3:182489803-182489825 GTGACTTATGTGGGCAAAGCAGG - Intergenic
967399640 3:189046304-189046326 GGCACTGAGGTAAGCACAGTCGG + Intronic
968751792 4:2393794-2393816 TTTACTGTTGTGAGCAAAGCTGG + Intronic
968975848 4:3821724-3821746 GGCACTGATGTGGTCTCAGCAGG + Intergenic
969051053 4:4373352-4373374 GGCACTTGTGTGTGCAAAACGGG - Intronic
969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG + Intronic
969588183 4:8106683-8106705 GGCACAAAGGTGAGCAAAGCAGG + Intronic
974087653 4:57278557-57278579 GGCACTGATGAGGGGAAAACTGG - Intergenic
976368519 4:84259265-84259287 GGCACTGGAGGGGGCAAAGCTGG - Intergenic
976781392 4:88762460-88762482 GGGATTGATGGGAGCACAGCAGG - Intronic
978234236 4:106438524-106438546 GGAAAGGATGAGAGCAAAGCAGG - Intergenic
984563598 4:181300840-181300862 GGCACTGAGCTGAACAATGCAGG - Intergenic
985354525 4:189103464-189103486 TGCACTGACGTGACCGAAGCAGG - Intergenic
986270688 5:6228204-6228226 GGCACAGAGCTGGGCAAAGCTGG - Intergenic
990174035 5:53087250-53087272 CCCACTCATGTCAGCAAAGCTGG + Intronic
990611979 5:57466744-57466766 GTCGCTTATGTTAGCAAAGCTGG + Intergenic
992974193 5:82096199-82096221 TGCACTGCTGTGAGAAAAGCAGG + Intronic
994665237 5:102697029-102697051 GGCAGAGATGTGACCAGAGCAGG - Intergenic
994827433 5:104732712-104732734 GGCACTGATGAGAGAGAAGTAGG + Intergenic
999563200 5:152827738-152827760 TGCACTCATGTGAGAACAGCAGG - Intergenic
1000755872 5:165159019-165159041 GGAACTAATGTGAGCAAAGTTGG - Intergenic
1001997012 5:176170251-176170273 GGCACTGTTGTGAGGAACGTGGG - Intergenic
1003340830 6:5218950-5218972 GGCAATGATGGCAGCAAAGAGGG + Intronic
1003628293 6:7763847-7763869 GCCATTGATGTGAGCCAAGAGGG - Intronic
1005221021 6:23588734-23588756 GGCAATGATGTGAGTAGAGGAGG + Intergenic
1005278885 6:24249451-24249473 AGCACAGCTGTGAGCAAAGCTGG - Intronic
1012346867 6:98199023-98199045 CACACTGATATGAGCAAAGGTGG - Intergenic
1013280007 6:108627238-108627260 GGCACTGAGGTGGGAGAAGCTGG + Intronic
1013774941 6:113669284-113669306 GGGACTAATTTGAGCAATGCAGG + Intergenic
1015311171 6:131768647-131768669 GGCAAAGATGGGAGCAGAGCAGG - Intergenic
1017742591 6:157420192-157420214 GGCACTGATGAGAGGAGAGAAGG + Intronic
1017742599 6:157420245-157420267 GGCACTGATGAGAGGAGAGAAGG + Intronic
1017742607 6:157420298-157420320 GGCACTGATGAGAGGAGAGAAGG + Intronic
1017742615 6:157420351-157420373 GGCACTGATGAGAGGAGAGAAGG + Intronic
1018310132 6:162500058-162500080 GGCACTCATATTAGCAAAGGTGG + Intronic
1018673034 6:166195240-166195262 GGCTCTGATGTCAGCCCAGCTGG - Intergenic
1018713310 6:166513239-166513261 GGCAGTGCTGTGGGCAGAGCTGG + Intronic
1018758311 6:166868587-166868609 GGAATTCATGTGAGCAAAGATGG + Intronic
1021430884 7:20557502-20557524 GACACTGAAATGAGCAGAGCAGG + Intergenic
1022479279 7:30732713-30732735 GGCACTTCTGTGATCAAAGGTGG - Intronic
1022961010 7:35426525-35426547 GACACTGAGATGAGCAAAGAGGG - Intergenic
1024301582 7:47891056-47891078 GGCAGTCATGTGAGCAGAGGAGG - Intronic
1024544830 7:50508452-50508474 GGCACTTACGTGAGCACAGAGGG - Intronic
1027915302 7:84310308-84310330 GGAAATTATGTGAGCCAAGCAGG + Intronic
1028169125 7:87574547-87574569 TACACAGAAGTGAGCAAAGCTGG - Intronic
1029161366 7:98554716-98554738 GCCACGGGTGTGAGCAGAGCAGG - Intergenic
1031702728 7:124945145-124945167 GGCACTGGTGGCAGCAGAGCTGG - Intergenic
1033040350 7:137911899-137911921 GGCACAGAAGTGAGAAGAGCAGG + Intronic
1033207328 7:139434244-139434266 AGCTCTGATAAGAGCAAAGCTGG - Intergenic
1036396369 8:8374795-8374817 GGCACTGATGTGATCTAACGTGG - Intronic
1036703500 8:11029722-11029744 GGCACTGACGTGAGGAAATGGGG - Intronic
1037636545 8:20705462-20705484 GGCACTGAGGTGAGGCAAGAGGG + Intergenic
1038157843 8:25007661-25007683 GGCACTGCAGTTAGCAACGCAGG + Intergenic
1038604498 8:28985624-28985646 GGCAGTGATCTGAGTACAGCTGG - Intronic
1038647560 8:29373929-29373951 GGCTGTGATGTGAGCCAGGCAGG - Intergenic
1040851662 8:51906835-51906857 GGGACTGACTTGAGCAAACCAGG - Intergenic
1045551387 8:103175783-103175805 GGCTCTGCTGTGGGCAAGGCAGG - Intronic
1046208412 8:111035139-111035161 GGCACTAAAGTGTGCAATGCAGG - Intergenic
1046573879 8:116000996-116001018 GGCTGTGATGTAACCAAAGCCGG + Intergenic
1046810309 8:118525921-118525943 TTCACTGATGTCAACAAAGCTGG - Intronic
1048242793 8:132760681-132760703 GCCACTGATGTGAGCCCAACAGG - Intronic
1049311095 8:141934293-141934315 GGCAGTGAGGGGAGCACAGCAGG - Intergenic
1053678783 9:40465216-40465238 GGCACTGATGTGATGCCAGCAGG - Intergenic
1053928768 9:43093569-43093591 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054284940 9:63159726-63159748 GGCACTGATGTGATGCCAGCAGG + Intergenic
1054291861 9:63300754-63300776 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054389879 9:64605297-64605319 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054505835 9:65911079-65911101 GGCACTGATGTGATGCCAGCAGG + Intergenic
1056065684 9:82931996-82932018 GTCACTTATTTGATCAAAGCTGG + Intergenic
1056334809 9:85557292-85557314 GGGACTGATGTGAGCACCTCGGG - Intronic
1057269831 9:93644613-93644635 GGCACAGTTGTGAGCAGCGCTGG - Intronic
1058693973 9:107543641-107543663 GGCACTGAAGTCTCCAAAGCTGG + Intergenic
1060090988 9:120743246-120743268 GGCACTGGGCTGAGCAAAGGTGG + Intergenic
1060190211 9:121587959-121587981 GGCACTGATGTGAGGAGATGGGG - Intronic
1060292623 9:122318439-122318461 TGCTCTGAAATGAGCAAAGCTGG + Intronic
1060898150 9:127232624-127232646 GGCACTGATATCAGCCAATCAGG - Intronic
1062238202 9:135522654-135522676 GTCACAGATGTGAGCCACGCGGG - Intronic
1185872123 X:3673230-3673252 GACAATGATGAGAGCAAAGAAGG + Intronic
1187219393 X:17308905-17308927 GGCACGGATCAGAGCAAAGAAGG - Intergenic
1189751816 X:44230210-44230232 CGCACTGATGAGAGCAAGGCTGG + Intronic
1190997243 X:55621909-55621931 GGCACTGATCTTGGAAAAGCAGG - Intergenic