ID: 1131513670

View in Genome Browser
Species Human (GRCh38)
Location 15:93063783-93063805
Sequence AACCAGCCACAGGAGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 473}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131513662_1131513670 23 Left 1131513662 15:93063737-93063759 CCACCCTTTGAATCCACTGGAAA 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1131513670 15:93063783-93063805 AACCAGCCACAGGAGAAAGAGGG 0: 1
1: 0
2: 4
3: 34
4: 473
1131513663_1131513670 20 Left 1131513663 15:93063740-93063762 CCCTTTGAATCCACTGGAAATTT 0: 1
1: 0
2: 3
3: 33
4: 323
Right 1131513670 15:93063783-93063805 AACCAGCCACAGGAGAAAGAGGG 0: 1
1: 0
2: 4
3: 34
4: 473
1131513661_1131513670 24 Left 1131513661 15:93063736-93063758 CCCACCCTTTGAATCCACTGGAA 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1131513670 15:93063783-93063805 AACCAGCCACAGGAGAAAGAGGG 0: 1
1: 0
2: 4
3: 34
4: 473
1131513667_1131513670 10 Left 1131513667 15:93063750-93063772 CCACTGGAAATTTTCTAGGAGGT 0: 1
1: 0
2: 2
3: 15
4: 166
Right 1131513670 15:93063783-93063805 AACCAGCCACAGGAGAAAGAGGG 0: 1
1: 0
2: 4
3: 34
4: 473
1131513664_1131513670 19 Left 1131513664 15:93063741-93063763 CCTTTGAATCCACTGGAAATTTT 0: 1
1: 0
2: 2
3: 24
4: 351
Right 1131513670 15:93063783-93063805 AACCAGCCACAGGAGAAAGAGGG 0: 1
1: 0
2: 4
3: 34
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131513670 Original CRISPR AACCAGCCACAGGAGAAAGA GGG Intronic