ID: 1131515918

View in Genome Browser
Species Human (GRCh38)
Location 15:93076710-93076732
Sequence CTTCATCTGCAAAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1171
Summary {0: 1, 1: 9, 2: 42, 3: 232, 4: 887}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131515918_1131515921 -10 Left 1131515918 15:93076710-93076732 CCATCCTCATTTTGCAGATGAAG 0: 1
1: 9
2: 42
3: 232
4: 887
Right 1131515921 15:93076723-93076745 GCAGATGAAGAAACTGAGGCTGG 0: 5
1: 26
2: 146
3: 398
4: 1368
1131515918_1131515922 -9 Left 1131515918 15:93076710-93076732 CCATCCTCATTTTGCAGATGAAG 0: 1
1: 9
2: 42
3: 232
4: 887
Right 1131515922 15:93076724-93076746 CAGATGAAGAAACTGAGGCTGGG 0: 31
1: 212
2: 791
3: 1819
4: 3403
1131515918_1131515923 19 Left 1131515918 15:93076710-93076732 CCATCCTCATTTTGCAGATGAAG 0: 1
1: 9
2: 42
3: 232
4: 887
Right 1131515923 15:93076752-93076774 TTAAGTACGCACCCAATAAATGG 0: 1
1: 0
2: 0
3: 16
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131515918 Original CRISPR CTTCATCTGCAAAATGAGGA TGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900508275 1:3041613-3041635 CTCCATCTGCAAAAAGTGGTAGG + Intergenic
901266019 1:7911445-7911467 CTTCATCTGTAAAATTACGTGGG - Intergenic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901300706 1:8198227-8198249 GTGCAGCTGTAAAATGAGGATGG + Intergenic
901304126 1:8220149-8220171 CTTCATCTAAAAAAAAAGGAAGG + Intergenic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
903073421 1:20741653-20741675 CTTAACCTACAAAATGAGGAAGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903288367 1:22291254-22291276 CTCCATCTGGGAAATAAGGATGG + Intergenic
903366965 1:22811097-22811119 CTTCATTTGTAAAATGAGAGGGG + Intronic
903452696 1:23465404-23465426 CTTCATCTTTAAAATGGGAATGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903659669 1:24969458-24969480 CCTCCTCTGAAAAGTGAGGAGGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904177579 1:28641818-28641840 CTTTATCTTCAAACTCAGGAGGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904324181 1:29717034-29717056 CTTTTTCTTCAAAATAAGGAGGG + Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904449942 1:30604744-30604766 CTTCATCTGTCAAATAGGGATGG - Intergenic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904894946 1:33809738-33809760 CATCATCTGCAAAAAAATGATGG - Intronic
904918366 1:33986432-33986454 CTTCAGCTGTAAAATGGGCATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905857154 1:41321676-41321698 CTTCTTCTGCACCATGGGGATGG - Intergenic
905922640 1:41729603-41729625 CTCCTTCTGTAAAATGAGTAGGG - Intronic
906002075 1:42435139-42435161 CTCCATCAGCAACATGGGGAAGG + Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
906899749 1:49821358-49821380 CTTCATCTGTAAAATTAAGATGG + Intronic
907315877 1:53572268-53572290 CTCCATCTGTAAAATGAGAATGG + Intronic
907318635 1:53588879-53588901 CTTCTTCTGTAAAATGGGCATGG + Intronic
907383704 1:54111699-54111721 TTTCATTTGCCAAATGAGGATGG - Intronic
907506928 1:54925938-54925960 CTTCTGCTGCAAAATGAGGGGGG - Intergenic
907684007 1:56591987-56592009 ATTCAGGTGAAAAATGAGGAAGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907747986 1:57233809-57233831 CTTCCTCTGCAAACTGAGAAAGG + Intronic
908645600 1:66274647-66274669 CCTCGTCTCCAAAATTAGGATGG + Intronic
908846807 1:68333023-68333045 CTTCATCTGTAAAATGACGGGGG + Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909113980 1:71511051-71511073 CTGCATCTGCAAAATTATCAAGG - Intronic
909748233 1:79125893-79125915 CTTTATTTGCAAGATGAGAATGG + Intergenic
910498545 1:87861776-87861798 CTTCAGGTGTAAATTGAGGAGGG + Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910725862 1:90338100-90338122 CTTCATCTACAAAATGATGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912563790 1:110570384-110570406 TTTGATCTGGAAAATGGGGATGG + Intergenic
913015566 1:114730528-114730550 CTTCATCTGCAATATGGAGCTGG + Exonic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
913665830 1:121048152-121048174 TTTCAACTGTAATATGAGGATGG - Intergenic
914017230 1:143831428-143831450 TTTCAACTGTAATATGAGGATGG - Intergenic
914160556 1:145129570-145129592 TTTCAACTGTAATATGAGGATGG + Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
914655841 1:149739968-149739990 TTTCAACTGTAATATGAGGATGG - Intergenic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915179770 1:154048172-154048194 CTTTTTCTTCAAAATAAGGAGGG - Intronic
915456342 1:156043360-156043382 CTTCATCTCCAGGATGAGGAAGG - Intronic
915493705 1:156266375-156266397 GTTCATCTGCGGAAAGAGGAAGG + Exonic
916252995 1:162756543-162756565 CTGCATCTGCAAAGTGAGCCTGG + Intronic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916744405 1:167673563-167673585 CAACATCTGTAAAATGAGGTGGG - Intronic
917217762 1:172695884-172695906 CTTCATTTGTAAAATAAGGTTGG - Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917522450 1:175759503-175759525 CTTCCTCTGCAACCTGTGGAGGG + Intergenic
917801195 1:178572229-178572251 CTTCACCTGTAAAATGAAGGCGG - Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917939363 1:179902598-179902620 ATTCATAGGAAAAATGAGGAAGG - Intronic
918118376 1:181516441-181516463 CTTCATCTGTAAAATGGGACTGG - Intronic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
918679683 1:187336848-187336870 TTTAATCTTCAAAATGAGTAAGG - Intergenic
919641885 1:200053413-200053435 CTTCATATGTAAAAAGAGGTAGG - Intronic
919753934 1:201054825-201054847 CTGCATCTCCAAAATGAGAAGGG - Intronic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920459524 1:206128579-206128601 CTTCAGCTACAACAAGAGGAGGG + Intergenic
920525523 1:206663376-206663398 CTTTAGTTGCAAAATCAGGATGG - Intronic
921117022 1:212101474-212101496 CTTTATCTATAAAAAGAGGATGG - Intronic
921292291 1:213670067-213670089 TGTCATCTGCAAAATGAAGCAGG + Intergenic
921300178 1:213744579-213744601 CTTTATCTGTAAAATGGGGCTGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921383457 1:214548125-214548147 CTTCATCTGCAAAATGGATCTGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
921639111 1:217530321-217530343 CTTCATCTACAAAATGGGGGTGG + Intronic
921790929 1:219289753-219289775 CTTAATTTATAAAATGAGGATGG - Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
923534224 1:234836433-234836455 CTTCCTCTGCAGTATAAGGAGGG + Intergenic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1064098957 10:12446707-12446729 CTCCAACTGCAAAAAGAGAAAGG - Intronic
1064188267 10:13182717-13182739 TTTCATCTCTAAAATGAGAAGGG + Intronic
1064291675 10:14040082-14040104 CTCCATCTGTAAAACAAGGATGG - Intronic
1064387411 10:14909036-14909058 CTTCACCTGCAAAAGGCTGATGG - Exonic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1065485664 10:26234356-26234378 CTTCATCTGTAAAACAAGGTGGG - Intronic
1065865214 10:29909124-29909146 CCTCCTGTGCAAAATGAGCAAGG + Intergenic
1065963403 10:30752399-30752421 TTTCATCTGCAGAATGACCAAGG - Intergenic
1066175924 10:32905796-32905818 CTTTATCTGCACAATAAGGTAGG + Intronic
1066988275 10:42487573-42487595 CTTTTTCTTCAAAATGATGAGGG - Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1068956666 10:62824660-62824682 CTTCATCTTGAAAATGAGACTGG + Intronic
1069629612 10:69889636-69889658 CTCCATCTGAAGCATGAGGATGG + Intronic
1069694215 10:70374930-70374952 CTTCATCTATAAAATGGGAATGG - Intronic
1069700533 10:70421539-70421561 CTTAATCTGAAAAATAAGAATGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070395567 10:76008923-76008945 CTTCATCTGCAAAAAAATAAGGG - Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070789790 10:79182204-79182226 TTTCATCTGAAAAATGAGCTTGG - Intronic
1071123607 10:82309224-82309246 ATTCATAGGCAAAATTAGGAGGG - Intronic
1071277153 10:84065729-84065751 CTCCATCTGCAAAATGGTGGTGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071393298 10:85196663-85196685 CTTCACTTGCAAATTGAAGATGG + Intergenic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1071693848 10:87851523-87851545 CTTCATTTGTAAAATGAGATTGG + Intergenic
1071792201 10:88966699-88966721 CCTCATCTGCAAAATGACAATGG + Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074198307 10:111208432-111208454 CCTCATCATCAAAATGTGGAGGG - Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074760543 10:116664420-116664442 TCTCTTCTGCGAAATGAGGAGGG - Intronic
1074769968 10:116726780-116726802 CTTCATGTGGAAAATGAAGTTGG + Intronic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075247805 10:120839582-120839604 CTTCATTTACAAAATGGGGTTGG + Intergenic
1075585731 10:123656753-123656775 CTCCACCTGCGAAATGAGGTGGG - Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1076127619 10:127987818-127987840 CTTCAAATGAAAAATGAAGAGGG - Intronic
1076161755 10:128249333-128249355 CTTCATCTGTTGAATGAAGAAGG + Intergenic
1076641713 10:131921296-131921318 CTGCACCTGCAAAGTGAGGCTGG - Intronic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1077490497 11:2858789-2858811 CTCCATCTGCTCACTGAGGAGGG - Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1078974550 11:16457538-16457560 CTTCATCTGTTAAATGGGTATGG - Intronic
1079016026 11:16869445-16869467 CTTCATCTCTAAAATGGTGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079122881 11:17697644-17697666 CCTCATCAGAAAGATGAGGATGG - Intergenic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1080002665 11:27367989-27368011 CTTCATCTGCATAATCAGAGTGG + Exonic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1081231712 11:40592581-40592603 CTACATCTGCAAAAAAAGGCAGG - Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081685057 11:45036566-45036588 CTTCATCTGCAGGATGGAGATGG - Intergenic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082060725 11:47857738-47857760 CTTTCTCTGCAAAATAATGATGG + Intergenic
1082265323 11:50111602-50111624 ATTCAGCTGGAAAGTGAGGAGGG + Intergenic
1082974860 11:59061396-59061418 CTCCAACTGAAAAATAAGGAGGG - Intergenic
1082979283 11:59105126-59105148 CTCCAACTGAAAAATAAGGAGGG - Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083700507 11:64474447-64474469 CCTTTTCTACAAAATGAGGATGG + Intergenic
1083739096 11:64698478-64698500 CCTCTTCTGCAAAATGAGAGGGG + Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085196717 11:74677087-74677109 CTTCAGCTGGAAAATGGGGGTGG - Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085636590 11:78163943-78163965 CTTCCTCGGCAAAATGTGCAAGG - Intergenic
1086116045 11:83251472-83251494 CTTCATTTATAAAATGAAGATGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086325706 11:85696669-85696691 CTTCATCTATAAAATGGGAATGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087101428 11:94369048-94369070 CTTCAGCTGAAATATGAGGAAGG - Intergenic
1087706102 11:101493626-101493648 TTTCATGTGCAAAATGGGAACGG - Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1087920237 11:103858587-103858609 TGTAATCTGTAAAATGAGGAAGG + Intergenic
1088142054 11:106629353-106629375 CTTAATCTGTCAAATGAGGGGGG - Intergenic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089112008 11:116064682-116064704 CTTCGTCTACAAAATGAGCTCGG - Intergenic
1089441904 11:118524586-118524608 GTTCATGGGCAAAAGGAGGAAGG - Exonic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089995203 11:122900099-122900121 CTTCTTCAGCAAAATGGGAATGG - Intronic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1090621689 11:128566415-128566437 CTTCATCTGTAAAATAGGCATGG - Intronic
1090641734 11:128735071-128735093 CTTCATCAGCAAAGTGGGGGAGG + Intronic
1091014741 11:132039768-132039790 TTACATCTGCAATATGAGCATGG - Intronic
1091099105 11:132853847-132853869 CTTCATCACCAAAATGTGCAGGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091869288 12:3873712-3873734 CTTCATCCTCAAAATGGAGATGG + Intergenic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1091997188 12:5002861-5002883 CCTGCTCCGCAAAATGAGGAAGG - Intergenic
1092035353 12:5329724-5329746 ATTCACCTGAAAAATGAGGAGGG + Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1092831711 12:12450292-12450314 CTTCATCTGTAAAAGGAAGGAGG - Intronic
1092984594 12:13833731-13833753 CTGCATCTGTAAAATGGGGTAGG - Intronic
1093395020 12:18670531-18670553 CTTCATCTGCAAAATCTCCAGGG + Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1093673540 12:21905815-21905837 CTTCATCAGTAAAATGAAGATGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094423305 12:30295046-30295068 CTCCTTCTGAAAAATAAGGAAGG + Intergenic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1095395131 12:41754190-41754212 CCCCTTCTGCCAAATGAGGATGG + Intergenic
1096070143 12:48770770-48770792 CTTCATCTGGAAATTGTTGAAGG + Exonic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097822936 12:64145873-64145895 CTTCATGTGCAATTTGGGGAGGG + Exonic
1098068928 12:66650928-66650950 CTTCATCTCCAAAATGAGCATGG + Intronic
1098366833 12:69712298-69712320 TTTCATCTACAAAATGAGAGGGG - Intergenic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098842969 12:75499229-75499251 CTAAATCTGCAAAATGAGCAAGG + Exonic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1099273671 12:80547874-80547896 CTTCATCTGTAACATGGGAATGG - Intronic
1099385641 12:82009475-82009497 CTCATTCTGCACAATGAGGACGG + Intergenic
1100483003 12:94997311-94997333 CTTCATCTGTGAAATGGGGGCGG + Intronic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100671653 12:96819839-96819861 CTTCAACTGCAACAGGAGGGTGG - Intronic
1100962708 12:99981704-99981726 CTTCATCTGTGAAATGACAATGG + Intronic
1101173211 12:102120787-102120809 CTTCACCTGCAAAACCAGGAAGG - Intronic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101659724 12:106754887-106754909 CTCCATCTGTAAAATGGGGTGGG + Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102199294 12:111046415-111046437 GTTCATCTGTAAAATGGGAATGG - Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102801690 12:115740670-115740692 CTCCATCTGTAAAATGGGGGTGG + Intergenic
1102866409 12:116378480-116378502 CTACATCTGGAAAATGGGGCTGG + Intergenic
1102912558 12:116728734-116728756 CTTCCTCTGTAAAATGGAGATGG - Intronic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1102958079 12:117072422-117072444 CCTCATCTGGAAAGTGAGCATGG - Intronic
1103139454 12:118535928-118535950 CTTCATCTGCAACATGGGTTTGG - Intergenic
1103598643 12:122040116-122040138 CTCCATCTGTAAAATGCGGTTGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106023288 13:25934534-25934556 CTTCATTTGGTAGATGAGGATGG - Intronic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106084514 13:26528689-26528711 TTTCATCTGAAAAATAAGGCAGG - Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108446295 13:50512144-50512166 CTTCAGCTGAGAAAAGAGGATGG + Intronic
1109862170 13:68214238-68214260 CTTCATCTGTAAAATGAAGTGGG + Intergenic
1110027923 13:70565562-70565584 CTTCATTGTCGAAATGAGGATGG - Intergenic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1111044047 13:82791481-82791503 ATTCATCAGGAAAATGAGAAAGG + Intergenic
1111771046 13:92596100-92596122 CTTCATCTGAAAAATTAAGAGGG - Intronic
1111855329 13:93630375-93630397 CTTCATCTGAATAATGAGCTAGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1112944708 13:104914084-104914106 CTTCATTTGGAGAATGCGGATGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1113673666 13:112194031-112194053 GTTTATCTACAAAATGAGGAAGG - Intergenic
1113734090 13:112664769-112664791 CTCCATCTGCCACAGGAGGAAGG - Intronic
1113963829 13:114140508-114140530 CTTCGTCTGTAAAATGGGGCTGG + Intergenic
1114262668 14:21049606-21049628 GCTCATTTGCAACATGAGGAAGG - Intronic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114416295 14:22546849-22546871 TTTCACCTGCAAAATGAATATGG - Intergenic
1115378977 14:32711878-32711900 CTTCATCTGTAAAGTGAGGGGGG + Intronic
1115448194 14:33516414-33516436 TTTCATCAGGAAGATGAGGAGGG - Intronic
1115508018 14:34111217-34111239 CTTCAACTAGAACATGAGGATGG - Intronic
1115675583 14:35669552-35669574 CTTCATCTATAAAATAAAGATGG - Intronic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116853935 14:49935508-49935530 CTCCATCTGTAAAATGAAGATGG + Intergenic
1117082350 14:52165412-52165434 CTTTTTCTTCAAAATAAGGAGGG - Intergenic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1117720152 14:58620999-58621021 CTTCATCAGCAAGCTGATGATGG - Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1117947876 14:61049467-61049489 CTACATCTTTAAAATGGGGATGG - Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118349954 14:64966666-64966688 CTGCATCTGTAAATTGAAGATGG - Intronic
1118398818 14:65360921-65360943 ATTGTTCTGCAAAATGGGGATGG + Intergenic
1118421103 14:65604836-65604858 ATTCCTCTGGAAAGTGAGGAAGG - Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118657811 14:67971832-67971854 CTCCATCTGTAAAATGATAATGG + Intronic
1118743703 14:68759068-68759090 CTTCATGTGTAAAATGCAGAGGG - Intergenic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118922103 14:70158985-70159007 CTTGATCTGCAAATAGAGCACGG - Intronic
1119026347 14:71155895-71155917 TTTCTTCTGGACAATGAGGATGG + Intergenic
1119060536 14:71469693-71469715 TCTCATGTGAAAAATGAGGAAGG + Intronic
1119113903 14:72000473-72000495 CTTCATCTTCAAGATGGGGTTGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1119893539 14:78200974-78200996 CTTCATCCGTGAAATGAGGCTGG + Intergenic
1119895321 14:78214976-78214998 CTTCGTCTGTAAAATGGGGGTGG + Intergenic
1120011406 14:79419740-79419762 CCTCATTGACAAAATGAGGATGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120154901 14:81082810-81082832 TTTCATCTGCAAAATTAGATGGG - Intronic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120899758 14:89565538-89565560 CTTCATGTCAAAGATGAGGACGG - Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121265146 14:92597046-92597068 CCTCATCTAGAAAATGCGGATGG + Intronic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121916198 14:97838649-97838671 TTTCATTTGTAAAATGATGAAGG + Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122107283 14:99468019-99468041 TGTCATCTGAAAGATGAGGATGG - Intronic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1123795481 15:23766282-23766304 CTTTATCAGCAACATGAAGACGG + Intergenic
1123827856 15:24101453-24101475 CTACATCTGCAAAAGGACGGAGG - Intergenic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124618756 15:31262101-31262123 TTTCCTCTGTAAAATGAGGTAGG + Intergenic
1124689135 15:31807185-31807207 TTTCACCTGCAAAATGGGAACGG - Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124783308 15:32656273-32656295 CGTCATCTGGAAAAAGAGGGAGG + Intronic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1125448679 15:39785074-39785096 CTTCATTTGAAAAATGAAGTTGG + Intergenic
1126600991 15:50427360-50427382 TTTCATCTGCAAAATGAAATAGG - Intronic
1126601143 15:50428715-50428737 TTTTATCTGCAAAATTATGAAGG - Intronic
1126711073 15:51456793-51456815 ATTCATCTGTAAAATGATAATGG + Intronic
1126718059 15:51543383-51543405 TTCCATATGCAAAATGAGAAGGG - Intronic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127397801 15:58556834-58556856 CTTCCTTTGCAAAATGATGTGGG + Intronic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128649930 15:69403135-69403157 TTTCATCTGAAAAATGAGACTGG + Intronic
1128650169 15:69405954-69405976 CTTCCTATGCAAAATGAGAAGGG + Exonic
1128670744 15:69573032-69573054 CATCATCTGCTAAAGTAGGAAGG + Intergenic
1128704213 15:69826969-69826991 CCTTCTCTGCAAAATTAGGAAGG - Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128790519 15:70430079-70430101 CATCTCCTTCAAAATGAGGATGG - Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1130076345 15:80694154-80694176 CTTCAGCTGCCAAATCAGGCGGG + Intronic
1130094158 15:80843899-80843921 CTTCTTCTGTAAAACAAGGAGGG - Intronic
1130123903 15:81076131-81076153 CTTCAATTGCAAAATTAGGAAGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130430854 15:83845550-83845572 TTTCATCTGCACAGTGAGCATGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130927039 15:88393300-88393322 CTTTATCTGTAATATGAGGATGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131533780 15:93216695-93216717 CTTCATTTGTAAAGTGAAGATGG + Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131941576 15:97572455-97572477 CATCATCTGCTAAAAGAGAATGG - Intergenic
1131966665 15:97851509-97851531 CATGATCTGAAAAATTAGGAAGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132816366 16:1829383-1829405 CTTCATCTGAGTAATGGGGATGG - Intronic
1133331787 16:4979402-4979424 CTCCATCTGTCAAATGCGGAGGG + Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133777186 16:8905980-8906002 CCTCATCTGCCAAATGAGTATGG + Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134158335 16:11862911-11862933 CTTCATCTGTTAAATGAAGCTGG + Intergenic
1134201143 16:12200122-12200144 TTTCATCTGTACAATGAGGTTGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1135155538 16:20049769-20049791 CTTTATCTGTAAAGTGGGGATGG + Intronic
1135893180 16:26375193-26375215 CTTCATCTGCAAGGTGGAGATGG - Intergenic
1136065425 16:27755195-27755217 CCTCATCTCCAAAATGAAGCTGG + Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136099156 16:27980567-27980589 CTTCATCTGTAAAATGGGTGTGG - Intronic
1136224133 16:28847138-28847160 CCTCATCTGCAAAATTAGATGGG - Intronic
1136237369 16:28923002-28923024 CTTCCTCTGTAAAATGGAGATGG + Intronic
1136369355 16:29826251-29826273 CCTCATCTACAAAATGAGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136517085 16:30774741-30774763 CAGCACCTGCAAGATGAGGAAGG - Exonic
1136556103 16:31008698-31008720 CCTGCTCTGCAAACTGAGGAGGG + Intronic
1136624834 16:31456000-31456022 CTTCATCTGTAAAACAGGGATGG - Intergenic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136863164 16:33714656-33714678 CTACATTTGGAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137598691 16:49741866-49741888 CCTCACCTAGAAAATGAGGATGG + Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741156 16:59312243-59312265 CTTCAACAGCAATATGAGGCAGG - Intergenic
1138834818 16:60421398-60421420 CTAGATCTGAAAAATGAGAAAGG - Intergenic
1139416134 16:66812279-66812301 CTTCATGTGTAAAATGGGGCCGG + Intronic
1140071134 16:71650834-71650856 CTTCATCTGTAAAATGAAAATGG + Intronic
1140194400 16:72844873-72844895 ATTCATCTCGGAAATGAGGAAGG - Intronic
1140739801 16:77931007-77931029 CTAAATCTGTAAAATGAGGAGGG - Intronic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141638747 16:85329237-85329259 GTTCATCTGTAAAATGGGGGTGG + Intergenic
1141709656 16:85690557-85690579 CTTTATCTTCAAAATGAAGTAGG + Intronic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1203124656 16_KI270728v1_random:1562809-1562831 CTACATTTGGAAAATGGGGATGG - Intergenic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1142928793 17:3264928-3264950 CTTCATGTGCAACATGGGGGTGG - Intergenic
1143439304 17:6956110-6956132 CTTCATCCATAAAATGAGGATGG + Intronic
1143833804 17:9673908-9673930 CTTCTTCTGTACAATAAGGAGGG + Intronic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144927372 17:18823591-18823613 CTTCATCCGCCAGCTGAGGAAGG - Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145271131 17:21405523-21405545 CTTCCTCTGAAAAACGAGGCTGG - Intronic
1145309335 17:21692910-21692932 CTTCCCCTGAAAAATGAGGCTGG - Intronic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145771004 17:27493071-27493093 CATCATCAGCAGAATGATGAAGG - Intronic
1145772818 17:27505614-27505636 CTTTATCAGTAAAATGGGGATGG + Intronic
1145790525 17:27623927-27623949 TTTCCTCTGCAAGACGAGGAAGG - Exonic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146270996 17:31485783-31485805 CTTCATCTGTAAGATGGGAATGG - Intronic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1146637649 17:34518189-34518211 CTGCATCTGTTAAATGGGGATGG + Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147043591 17:37736434-37736456 CTTCATCTGTAAAATGGAGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147171128 17:38619575-38619597 CTTCATCTGTAAAATGGGCCTGG + Intergenic
1147442238 17:40454221-40454243 CCTCATCTCCAAAATGAGTGAGG - Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147627137 17:41907489-41907511 CTACATCTGCAAAGTGAAGTGGG - Exonic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148375449 17:47140507-47140529 CTTCCTCTGAAAAATGATTATGG + Intronic
1148865016 17:50623890-50623912 CTGCATCTGCAAAAGGAACAGGG - Exonic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1149277963 17:55065972-55065994 CTTTCTTTGCAAAATGAGCATGG + Intronic
1150233319 17:63571626-63571648 CCTTTTCTGAAAAATGAGGATGG + Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1151571652 17:74929089-74929111 CTTCATCTGCAAAACCAGCTGGG + Intronic
1151701082 17:75742891-75742913 CTCCATCTGTAAAATGGGTAAGG + Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152498629 17:80693478-80693500 CCTCTTCTGCAAATTAAGGAAGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153170369 18:2309519-2309541 CTCCATCTGCAAAATGGAGCTGG - Intergenic
1153413380 18:4818745-4818767 TTTCCTCAGCAAAAGGAGGAAGG - Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153970778 18:10225138-10225160 CTTTTTCTTCAAAATAAGGAGGG + Intergenic
1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG + Intergenic
1155073527 18:22336277-22336299 CTTCAGGTGCAAAGGGAGGAGGG + Intergenic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155216354 18:23646688-23646710 CTTCATCTTCAAAATGATTCAGG + Intronic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155413664 18:25572640-25572662 CTTTATTTGCAGCATGAGGATGG - Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156190923 18:34719425-34719447 CTTCATCTGTAAAATAAAGATGG - Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157165382 18:45354036-45354058 CTTCATCTGTAAAATATTGAAGG + Intronic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157467021 18:47956059-47956081 CTTCATCCTCAAAATCAGGGTGG - Intergenic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157514905 18:48304005-48304027 CTTCATCTGCAAGATGGGGGTGG - Intronic
1158514299 18:58118745-58118767 CTTCATCTCCCAGCTGAGGAAGG + Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158837077 18:61342357-61342379 CTGCATCTACAAAGTGAAGATGG - Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159052042 18:63429418-63429440 CTGCATCTGTAAAATGGGGGTGG + Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1160620918 18:80169998-80170020 CTTCAGCTGCCAGATGAGCACGG + Exonic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161692568 19:5745320-5745342 CTACATCTTCAAAATGAGGCCGG + Intronic
1162058701 19:8081421-8081443 CTTCCTCTGCAAAAACACGAAGG - Exonic
1162082372 19:8225890-8225912 GTTCATCTGTGAAATGAGAATGG + Intronic
1162107416 19:8378429-8378451 CTGCATTTGGAAAATGGGGATGG + Intronic
1162475489 19:10896928-10896950 CTTCATTTGCAAAACCCGGAAGG - Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162642516 19:12022817-12022839 CTTTTTCTTCAAAATAAGGAGGG - Intronic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163172836 19:15544407-15544429 CTTCAGCTACAAAATGGGGGTGG + Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1166064547 19:40349545-40349567 CTTCATCTGCAAAATGCACACGG + Intronic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1166156953 19:40920906-40920928 CTCCATCTATAAAATGGGGATGG + Intergenic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166166020 19:40989380-40989402 CTCCATCTATAAAATGGGGATGG + Intergenic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167419196 19:49393359-49393381 CTTCCTCTGGAAAATGGGGTTGG - Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167863714 19:52306922-52306944 CTTTTTCTTCAAAATGATGAGGG + Intronic
1168150510 19:54445055-54445077 GTCCATCTGCAAGCTGAGGAAGG - Intergenic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925606066 2:5661473-5661495 CTGCATCTTCAACATGAGGCTGG + Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926389836 2:12378148-12378170 TTTCATCTGCAAAATAGAGATGG + Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926868117 2:17381868-17381890 CTTCATCTATAAAATAAAGAGGG - Intergenic
926882311 2:17559579-17559601 CATCATATGTAAAATGAGTAGGG + Intronic
926946930 2:18198577-18198599 CTTCATCTGTGAATTGAGGCAGG - Intronic
926993254 2:18703324-18703346 ATTCATCTCCACAATAAGGAAGG + Intergenic
927304425 2:21554283-21554305 CTTTATCAGCAAAATGAAAATGG + Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
930034588 2:47077520-47077542 CTTCATCTGTACAATAAGAATGG + Intronic
930183200 2:48385349-48385371 CTTTTTCTTCAAAATAAGGAGGG - Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931616145 2:64160186-64160208 CTTCATCTAAACAATGATGATGG - Intergenic
931647758 2:64440628-64440650 CATCCTCTGGAAAATGAGCATGG - Intergenic
931848837 2:66233013-66233035 CTTGGTCCTCAAAATGAGGAGGG + Intergenic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932299843 2:70658748-70658770 CTGCATGTGTAAAATGAGTAAGG + Exonic
932414558 2:71565759-71565781 TATCATCTGTAAAATGAGGGTGG + Intronic
932449427 2:71800133-71800155 CTTCATTCACAAAATGGGGATGG - Intergenic
932877266 2:75465999-75466021 CTTCAACTGTAACATGAAGATGG - Intergenic
932958913 2:76389261-76389283 CTTCCTCTGCATAATGACTAGGG + Intergenic
932970497 2:76535151-76535173 CTTCATATGGTAAAAGAGGAAGG + Intergenic
933267164 2:80193485-80193507 CTGCATCTGTAAAATGGAGAAGG - Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933372301 2:81430543-81430565 ATTCATTTGCAATATGAGTAGGG + Intergenic
933737250 2:85504987-85505009 ATTCATCTGGGTAATGAGGAGGG + Intergenic
933737398 2:85506019-85506041 GTTCATCTGGCTAATGAGGAGGG + Intergenic
934717663 2:96552863-96552885 CCCCATCTCCACAATGAGGAAGG - Intergenic
934815173 2:97319509-97319531 CTCCCTCTGCAAAATGAACAAGG + Intergenic
934822522 2:97388974-97388996 CTCCCTCTGCAAAATGAACAAGG - Intergenic
934874906 2:97908558-97908580 CTTCTTCACCAAAATGAGCAAGG + Intronic
934896655 2:98125477-98125499 CTTCATCTGTAAACTGGGCATGG + Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937156627 2:119724566-119724588 GATCCTCTGAAAAATGAGGATGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937228675 2:120384336-120384358 TTTCATGTGCAAAATGGGGCTGG + Intergenic
937239335 2:120450256-120450278 ACTCATCTGCCAAATGAGGCTGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937631144 2:124102384-124102406 TTTCATCTGCAAAATCAGCCAGG - Intronic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
938161174 2:128985893-128985915 TTTCATCTGTGAAATGAGAATGG - Intergenic
938509273 2:131923558-131923580 AATCAACCGCAAAATGAGGAAGG + Intergenic
938766578 2:134463926-134463948 CTTCATCTGGAGCTTGAGGAAGG + Intronic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
939303509 2:140379024-140379046 TTTCATCTGGAAAATGAAGTAGG + Intronic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
939621127 2:144420482-144420504 CTTCAGCTGAAAAATGAGGGTGG - Intronic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
940024504 2:149191972-149191994 CTTCTTCAGCAAAGTGAGAAAGG + Intronic
940345532 2:152624161-152624183 CTCCATCTCAAAAAAGAGGAAGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941129374 2:161627031-161627053 CTTCAACTGAAAAATGAAAAGGG + Intronic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
941907818 2:170734077-170734099 CCTTATCTGAAAACTGAGGAAGG + Intergenic
942542907 2:177033267-177033289 CTTCCTCTGCATAATGAGTTGGG - Intergenic
943062463 2:183052910-183052932 CTTTTTCTTCAAAATAAGGATGG + Intergenic
943235949 2:185319764-185319786 CCTTATCTGCAAATTGAAGATGG + Intergenic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
944020737 2:195100590-195100612 ATTCATCTGTAAAATGGAGAAGG + Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945142578 2:206702694-206702716 CTTCATTTGTAAAATAAGGTGGG + Intronic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945665847 2:212741311-212741333 TCTTATCTGCAACATGAGGAAGG - Intergenic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946465860 2:219911518-219911540 CCTCATTTGCAAAATAAAGATGG + Intergenic
946968801 2:225068777-225068799 CTTCATCTGCAGCATGAAAACGG + Intergenic
947499533 2:230661790-230661812 CTGCATCTGAGAAATGAGTATGG + Intergenic
947914846 2:233824447-233824469 GTAAATCTTCAAAATGAGGATGG + Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948243251 2:236456269-236456291 CCTCATCTTAAAAATGAGGTAGG - Intronic
948447064 2:238041001-238041023 CCCCATCTGGAAAATGAGAAGGG + Intronic
948949060 2:241237038-241237060 CTTCATCTTCAAGGTGAAGAAGG - Intronic
1168870653 20:1125391-1125413 CTTCATCTGTGAAGTGAGGTGGG + Intronic
1169543599 20:6628349-6628371 CTTCATCTGCAAGAAGACTAGGG - Intergenic
1170057726 20:12225222-12225244 CTTCATCTGTGAAATGAGTACGG + Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170401481 20:15989027-15989049 CTTCATCTGTAAGATGATGATGG + Intronic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1170529437 20:17275742-17275764 CTTGGTCTGGAAAAAGAGGAGGG + Intronic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1171213337 20:23333983-23334005 CATCACCTGCAAAATGATCAAGG + Intergenic
1171225470 20:23438774-23438796 CTTCACCTGTAATATGAGAATGG - Intergenic
1171902356 20:30869341-30869363 CCTCCTCTACAAAATAAGGATGG + Intergenic
1172034887 20:32003602-32003624 CTTTATCTGTAAAATGAGTTTGG - Intergenic
1172114312 20:32564668-32564690 CTTCATCTGTAAAATGGGCTAGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172330885 20:34075391-34075413 CCCCATATGCCAAATGAGGATGG - Intronic
1172505522 20:35459213-35459235 CCTTATCTGCAAGATGAGGGGGG + Intronic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172840384 20:37899512-37899534 CTCCATCTGTAAAAGAAGGAAGG + Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173795130 20:45854596-45854618 CTTCAGCTGTAAAATGGAGAAGG - Intronic
1173818788 20:46007721-46007743 CTTCAACTGCAAATTGGGGCAGG - Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174706811 20:52664751-52664773 TCTCATCTGCAAGATGAGGTGGG - Intergenic
1174813868 20:53670113-53670135 TTTCATCTGTAAAATAAGAAAGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175072268 20:56344421-56344443 CTTCATCTGCAAAATCGAAATGG + Intergenic
1175177934 20:57124690-57124712 CGTTATCTATAAAATGAGGAAGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175572385 20:60033851-60033873 TTTCCTCTGCAAACTGTGGATGG + Intronic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1176784212 21:13234986-13235008 AATCAACCGCAAAATGAGGAAGG - Intergenic
1176996765 21:15563831-15563853 CTTCAGCTAATAAATGAGGAAGG + Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178471482 21:32897433-32897455 CCTCATCTAGAAAACGAGGATGG - Intergenic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179237696 21:39562127-39562149 CTTCATCTATAAAATGATGATGG + Intronic
1179293523 21:40040753-40040775 CTGCATCTGTAAAATGGGAATGG - Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1181949392 22:26543075-26543097 CTTCAGCTGCAAAATCAGGGTGG + Intronic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182088823 22:27580265-27580287 CCTCATCTGCAAGCTGAGCAGGG - Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182159011 22:28103284-28103306 CTTCATTTGCAAGAAGAGGAAGG + Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182412058 22:30195654-30195676 CCTCATCTACAAAATGAGATTGG - Intergenic
1182509051 22:30806125-30806147 CTTCATTTGTATAATAAGGATGG - Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1182996244 22:34815478-34815500 CCTCATCTACAACATAAGGATGG - Intergenic
1183172310 22:36197406-36197428 CTTCTTCACCAAAAGGAGGAAGG + Intronic
1183180950 22:36259338-36259360 CTTCTTCACCAAAAGGAGGAAGG - Intronic
1183234168 22:36604633-36604655 CTCCATCAGCAAAAAGATGATGG + Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183442657 22:37831961-37831983 CTGCATCTGCAGACTGAGGGAGG + Exonic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1183594403 22:38801669-38801691 CTTCATCTATAAAATGGGAAGGG + Intergenic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184330339 22:43823255-43823277 CTCCATCTGCAAAGTGAGGTGGG - Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184384835 22:44168079-44168101 CTTCATCTGTAAAATGGGCCTGG - Intronic
1184581754 22:45422677-45422699 CTTCTTCTGTAACATGAGGATGG + Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949664646 3:6323223-6323245 TTTCGTCTGTAAAATGAGCATGG - Intergenic
949725259 3:7036896-7036918 CTCCATCTACAAAATGAGTCTGG + Intronic
949876251 3:8627901-8627923 CTTCATCTGTAAAATGGTGCGGG + Intronic
949928599 3:9060809-9060831 CTCCATCTGCTAGATGAGTAAGG + Intronic
950108916 3:10406002-10406024 CTTCATGTACAAAATGATGTTGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950463224 3:13138085-13138107 CTCCATATGCAAAATGAGAGGGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950648636 3:14393437-14393459 GTCCATCTGTAAAATGAGGATGG - Intergenic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950711022 3:14812764-14812786 CTTTATCTGAAAAATGGGGTTGG + Intergenic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951800688 3:26592579-26592601 CTTCATATGCAAGGTGAGTATGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
951983426 3:28591040-28591062 ATTCATCAGAAAAATGAGCATGG + Intergenic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952676945 3:36043990-36044012 CTCCATCTGAAAAAAAAGGAGGG - Intergenic
952713070 3:36451383-36451405 ATTAATCTGCAAAAACAGGAAGG - Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953203412 3:40798424-40798446 CTTCATCCATAAAATGGGGATGG + Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
954231321 3:49219969-49219991 CTTTTTCTTCAAAATAAGGAGGG - Intronic
954260393 3:49434469-49434491 CTTCATCTCAAAAATGCGGCCGG + Intergenic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954719759 3:52551444-52551466 CTTTATATGCAAAATGACAAAGG + Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955510458 3:59675574-59675596 CTTTATCTGCAAAATGGGAGTGG - Intergenic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956686105 3:71828985-71829007 CTTCATCTTTAAAATGAAGGTGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
957873924 3:86120625-86120647 CTTTATCAGCAACATGAGAACGG - Intergenic
958683839 3:97366998-97367020 CTTCATCTGTCATAAGAGGATGG - Intronic
959192650 3:103134837-103134859 CTTCATCTGCTATTTGATGAAGG + Intergenic
959197918 3:103209767-103209789 CTTTTTCTTCAAAATAAGGATGG - Intergenic
959276805 3:104286638-104286660 CTTTTTCTTCAAAATAAGGAGGG + Intergenic
959861921 3:111226149-111226171 CTTCATCTTCAAAGCTAGGAGGG + Intronic
960031358 3:113058113-113058135 CTTCATCTGCAAGATGGGTGGGG - Intergenic
960100450 3:113736988-113737010 CATCATCTGTAAAATGAAGGGGG - Intronic
960376744 3:116911760-116911782 CTTCAACTGGAAAATGAGAAAGG + Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961404071 3:126666636-126666658 GTTCATCTGCAACATGGAGATGG - Intergenic
961846474 3:129768753-129768775 CTTCATCTGTAAAATAAAGGTGG + Intronic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963261800 3:143200074-143200096 TTTCACCTGTAATATGAGGAAGG + Intergenic
963316325 3:143762709-143762731 ATTCGTCTGAAAATTGAGGAGGG - Intronic
964091052 3:152876012-152876034 TTCCATCTGTAAAATGAGGGTGG - Intergenic
965365252 3:167790355-167790377 CTTCACCTGAAAGATGAGAAAGG - Exonic
965543656 3:169894135-169894157 CATCATCCACAAAATGAGAATGG + Intergenic
965633398 3:170756368-170756390 CTACCTCTGTAAAATAAGGAGGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965771978 3:172191097-172191119 CTTCGTCTGGAACATAAGGAGGG - Intronic
965847009 3:172974808-172974830 CTTCAACTGGAAAGTGAGGATGG - Intronic
966451011 3:180061892-180061914 CTTTATCTGAAAAATGACTAGGG + Intergenic
966744211 3:183260186-183260208 TATCTTCTGCAAAATGTGGAGGG + Intronic
966754048 3:183351855-183351877 CTTCATCTGCAAAATGGTGGGGG + Intronic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
967316953 3:188158693-188158715 TCTCATCTGCAAAATGAGACTGG - Intronic
967711902 3:192718503-192718525 CTTCATCTGCAAAACAAGAGTGG - Intronic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969347750 4:6579900-6579922 CTACATCTGCAAAATGAAACTGG - Intronic
969501721 4:7557354-7557376 CTTCATCTGTAAATTGGGGTTGG + Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970795976 4:19914058-19914080 CTCCATTTACAAAATGAGGGAGG + Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971465498 4:26954610-26954632 CTTCATTGCTAAAATGAGGAGGG + Intronic
972339683 4:38140729-38140751 TTTCATGTACAAAATGAGGTGGG - Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973702006 4:53546727-53546749 CTTCCTCTTCAAACTGGGGAAGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
974744374 4:66051755-66051777 CTTCATTTGAAAAATGATGATGG - Intergenic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
975471351 4:74772689-74772711 CCGCATCTGCAACCTGAGGATGG + Intronic
976049826 4:80998446-80998468 CTTCATCTGGAAATTAAGTATGG - Intergenic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976443153 4:85100184-85100206 CTTTATCTATAAAATAAGGATGG - Intergenic
976673042 4:87674808-87674830 CTTCATCAGCAACATGAAAATGG - Intergenic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
977767107 4:100811952-100811974 CTGCAACTGGAAAATGATGAAGG - Intronic
977805219 4:101289512-101289534 GTTTCACTGCAAAATGAGGAAGG - Intronic
978015806 4:103744641-103744663 ATTCAACAGCAAAATGAAGATGG - Intergenic
978550881 4:109925498-109925520 CTTCATCTGCAAAAATAAAATGG - Intronic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
978634800 4:110791554-110791576 CATCATCTGCACAATGAGCAGGG + Intergenic
979442526 4:120768338-120768360 CCTCATCTAGAAAATGAGAATGG + Intronic
980074019 4:128274909-128274931 TTTTATCTGCCAAATGGGGAAGG - Intronic
980423228 4:132592234-132592256 CTCCATCTCCATGATGAGGAGGG - Intergenic
980860426 4:138493084-138493106 CTTTATCTGGAACACGAGGATGG - Intergenic
981197729 4:141940768-141940790 CTTTTTCTTCAAAATAAGGAGGG + Intergenic
981744859 4:148042913-148042935 CTGCCTCTACAAATTGAGGAGGG - Intronic
982186383 4:152805771-152805793 CTTCATCTGTAAGATGATAATGG - Intronic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
983261674 4:165463689-165463711 GTTTATCTGCAAAATGAAGTTGG + Intronic
983891800 4:173037332-173037354 CTTCATCAGTAAAATGAGGTGGG - Intronic
984169653 4:176344568-176344590 CTTTTTCTTCAAAATAAGGAGGG - Intergenic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
984682614 4:182627288-182627310 CTTAATGTATAAAATGAGGATGG - Intronic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985500721 5:242970-242992 CTTTTTCTTCAAAATAAGGAGGG - Intronic
985736138 5:1584548-1584570 CTTTTTCTTCAAAATAAGGAGGG + Intergenic
987061159 5:14245439-14245461 CTTCATCTACAAGTGGAGGAGGG - Intronic
987333540 5:16878021-16878043 CTCCATCTGTAAAATGGGAATGG - Intronic
987650659 5:20736338-20736360 CTTCATCAGCAAAATGAGATGGG - Intergenic
987873663 5:23651632-23651654 CCTCAGCTGCAATATGAGGTTGG - Intergenic
988744893 5:34125123-34125145 CTTCATCAGCAAAATGAGATGGG + Intergenic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990370335 5:55111519-55111541 TTTTAACTGCAAAAAGAGGATGG + Intergenic
990382795 5:55232967-55232989 CTCCATCTGTAAAATGAGGCCGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990544312 5:56807215-56807237 CTTCACCTGGAAAATGGCGATGG + Intergenic
990799726 5:59587019-59587041 GTTCAACTGCAAAAGTAGGAAGG + Intronic
991019913 5:61969785-61969807 CTCCATCTGTAAAATGAAAATGG - Intergenic
991326073 5:65434515-65434537 ATTCATCTACGACATGAGGAGGG + Intronic
991485486 5:67131393-67131415 CTTCACCTGTAATACGAGGATGG - Intronic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992009371 5:72511532-72511554 CTTCATCTGTAAAAAGGGCAGGG - Intergenic
992030388 5:72715287-72715309 CCTCATCAGCAATGTGAGGAAGG - Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993090293 5:83417751-83417773 CTTCATCGATAAAATAAGGAAGG - Intergenic
993435771 5:87891760-87891782 CTCCATCAGCAACATAAGGAAGG - Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
995045266 5:107639448-107639470 CCTTAACTGCAAAATGAAGATGG + Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995441146 5:112193599-112193621 TCTCTTCTGAAAAATGAGGAAGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997277901 5:132613270-132613292 CTTCAGCTGAAAACTGAGAAAGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998145375 5:139724839-139724861 CTTCATCCGTAAAATGACCACGG - Intergenic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998480224 5:142457025-142457047 CTCCACTTGTAAAATGAGGATGG - Intergenic
998831872 5:146168199-146168221 CTTCATCTGGAAAATCAGGGGGG + Exonic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999141150 5:149362950-149362972 CTCCATCTGTAAAATGAGATTGG - Intronic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000379128 5:160613183-160613205 CTTCACCTGGAAAATCAGGGTGG + Intronic
1000776760 5:165429468-165429490 CTCCATCTAGAAAATGAGGACGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001284623 5:170413534-170413556 CTTCATCTGCAAGATGGGAATGG + Intronic
1001769380 5:174281508-174281530 CTTGTTCTGCAAAATGGGGTTGG - Intergenic
1001949793 5:175808228-175808250 TTTCATCTATCAAATGAGGATGG + Intronic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002155084 5:177271415-177271437 CCTCATCTGCAAGATCAGGATGG - Intronic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1002638751 5:180620608-180620630 CATCTTCTGTAACATGAGGAGGG - Exonic
1002763552 6:219705-219727 CTCCACCTGCAAAATGAGGTGGG - Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1002833271 6:843602-843624 CACCATCTGCAAGCTGAGGACGG - Intergenic
1003458864 6:6310659-6310681 TCTCATCTGCAAAATGAAGTTGG + Intronic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1003718733 6:8676514-8676536 CTTCATCTGTCAAATGAACAGGG - Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004928938 6:20443048-20443070 CCTCATCTGCCAAAAGAAGATGG - Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007886550 6:45236543-45236565 CTTTTTCTTCAAAATAAGGAGGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008036825 6:46753795-46753817 CTTCTGCTGCAAAATGAGCTGGG - Exonic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1008169928 6:48192013-48192035 CTTGATTTTCAAAATGAAGAAGG + Intergenic
1008250623 6:49235448-49235470 CTTCATGAGAAAAAGGAGGAAGG - Intergenic
1008476125 6:51937715-51937737 CTCCATCTGTAAAATGGGCATGG + Intronic
1009194497 6:60667805-60667827 CTTCATCTGCAGCATGAAAATGG - Intergenic
1010189630 6:73181852-73181874 CTTTATCTGCAAAACAGGGATGG + Intronic
1010337159 6:74700109-74700131 CTTCCTCCACAAAATGAGGATGG - Intergenic
1010350183 6:74864277-74864299 CTTTATCTGGCAAATGAGTAGGG - Intergenic
1010359708 6:74978436-74978458 CTTAATTTGCAACATGAAGATGG - Intergenic
1011350850 6:86422107-86422129 CTTCATTTGCAAAATGGTGTGGG + Intergenic
1012784536 6:103606629-103606651 TTTCATATATAAAATGAGGATGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1012977447 6:105795436-105795458 CTTCATCTATAAAACAAGGATGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013521487 6:110937777-110937799 CTCCATCTGTAAACTGAGGGTGG + Intergenic
1013691427 6:112649264-112649286 CCTCATCTGGAAAATAAAGAAGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015167271 6:130211965-130211987 CTTCAACTGTAAAATGAAGTAGG - Intronic
1015403035 6:132808393-132808415 CTGGATCTGCAAAATGAAGTAGG - Intergenic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1016106701 6:140172150-140172172 CTTCATCAGCAACATGAAGATGG - Intergenic
1016492565 6:144623205-144623227 CTTCATCTGTAATATGAGAAAGG + Intronic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1016676328 6:146773607-146773629 CTTCATCTGTAAAACTGGGATGG - Intronic
1016840025 6:148516701-148516723 CCTCATTTTCGAAATGAGGATGG - Intronic
1017094968 6:150796742-150796764 CTTCATCTATGAAATGGGGAAGG - Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1017492806 6:154958989-154959011 TTTCATCTGGGAAATCAGGAGGG - Intronic
1017507998 6:155086325-155086347 CTTCATCTGCAAAGTGAACAGGG + Intronic
1017641422 6:156497984-156498006 CTTCTTCTGGAAAATGACGGTGG + Intergenic
1017700300 6:157063065-157063087 CTTCAAATCCAAGATGAGGATGG - Intronic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019972428 7:4551795-4551817 CCTCTTCTGCAAATTGAAGATGG + Intergenic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1020678135 7:11204127-11204149 CTACCTCTGTAAAATGGGGACGG + Intergenic
1021063818 7:16147237-16147259 CTTTATTAGCAACATGAGGATGG + Intronic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1021798361 7:24280280-24280302 CTCCAGCTGCAATATGAAGAAGG + Intergenic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022039350 7:26565417-26565439 CTTGACCTGCACACTGAGGATGG + Intergenic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023595995 7:41829921-41829943 CTGGATCTGCCAAAGGAGGAAGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023733815 7:43217658-43217680 CTTTACTTGCAAAATGATGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1024336864 7:48217622-48217644 TCTCATCTTCAAACTGAGGAAGG + Intronic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1024976566 7:55119039-55119061 CTTGAACTGTAAAATGAGCAGGG - Intronic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1025807110 7:64844532-64844554 CTGCATCCGCAAAATGAGAAAGG + Intergenic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027109220 7:75423789-75423811 TCTCATCTGACAAATGAGGAAGG + Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1027865207 7:83637650-83637672 CTTCTGCTGCCATATGAGGAAGG + Intronic
1028137559 7:87238297-87238319 CTTGATCTGTCAAATGGGGATGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030926682 7:115465784-115465806 CTTTCTCTGTAAAACGAGGATGG - Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031268892 7:119619658-119619680 CTTAAGTTCCAAAATGAGGAAGG + Intergenic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032689589 7:134269938-134269960 GTTCTTCAGCAAATTGAGGAAGG - Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032708108 7:134439701-134439723 CTTCATCACCACAATGAGGCAGG + Intergenic
1033192671 7:139296356-139296378 CTTCATGTGCAAAAGCAGGCAGG + Intronic
1033420624 7:141201579-141201601 CATCATCTGCAAAATACTGATGG - Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033542730 7:142372279-142372301 CTTGCTCTGCAGGATGAGGAGGG + Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1033755270 7:144393806-144393828 CTCCAAGTGCAAAATGAGGAGGG + Intergenic
1034246813 7:149651150-149651172 CTTTTTCTTCAAAATAAGGAGGG + Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035584842 8:764190-764212 CTTCATTGCCAAAATGAGGCAGG - Intergenic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036420247 8:8588751-8588773 GTTTATCTGGAAAATGAGAAAGG + Intergenic
1036563597 8:9919120-9919142 CTTCTGCTGCCAAATGAGGTAGG + Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1039783670 8:40813324-40813346 CTTCTTCTGTAACATGAGGTTGG - Intronic
1040485307 8:47865581-47865603 CTTCATCTGTAAAAATAAGAGGG + Intronic
1040566930 8:48575925-48575947 CCTCATCTGCAAAACAAGGTGGG - Intergenic
1040956296 8:52983233-52983255 CTTTATCTTCAAAATCCGGAAGG + Intergenic
1041009369 8:53526584-53526606 CTTCACCAGCAAAAAGATGATGG + Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042446329 8:68889475-68889497 CTTTTTCTTCAAAATAAGGAGGG - Intergenic
1042636123 8:70877414-70877436 TGTAATCTGTAAAATGAGGATGG - Intergenic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044457733 8:92407580-92407602 CTACATATGCAAAATGATGTGGG - Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044912116 8:97071361-97071383 TTTCATCTGCAAAATAAGTCTGG + Intronic
1044928941 8:97233535-97233557 CTTCATCAGTAAAACGAGGACGG + Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045147073 8:99357959-99357981 CTTCATTGGTAAAATGGGGATGG + Intronic
1045362520 8:101446050-101446072 CTTCATCTGAAAAACAGGGATGG - Intergenic
1046744137 8:117858982-117859004 CTTCACCAGCAAAATGATTATGG + Intronic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1046843335 8:118885851-118885873 CTTCATCAGCACAATGAAAATGG - Intergenic
1046971314 8:120226610-120226632 CTTCCTCTGTAAACCGAGGAAGG - Exonic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047199079 8:122748726-122748748 CTTCATCAGCAGAATGAAAATGG - Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048180274 8:132188010-132188032 CTTCATCTCTAAAATGGGAATGG - Intronic
1048590229 8:135814497-135814519 CTGCATCTGTAAAATGATGATGG - Intergenic
1048609845 8:136010249-136010271 TCTCATCTCCAAAATAAGGACGG + Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049564988 8:143333536-143333558 CTTCATCTGTGAAATGAGACTGG - Intronic
1050150442 9:2614506-2614528 TTTCATCTGAAAAATGGGGGTGG - Intergenic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1052610347 9:30764801-30764823 CTTATTCTTCAAAATGTGGAGGG - Intergenic
1053087868 9:35243073-35243095 CTTCATCTACAAAATAACAATGG + Intronic
1053126207 9:35582790-35582812 CTTTTTCTTCAAAATAAGGAGGG - Intergenic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1054875458 9:70091662-70091684 CTTCATTTCCTAAATCAGGAAGG - Intronic
1055495504 9:76850505-76850527 CTGCATCAGCTAAATGATGAAGG - Exonic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056089220 9:83187947-83187969 CTTCATCTGCAAGACGGGGGTGG + Intergenic
1056366559 9:85910787-85910809 CTTCATCTGGACCATGAGAAAGG + Intergenic
1056789645 9:89617264-89617286 CTTCATCTGAAACATCTGGAAGG + Intergenic
1056791748 9:89630240-89630262 CTGCTTCTGGAAAAGGAGGAGGG - Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057052828 9:91938613-91938635 CTTCATCTCAAAAAGGAAGAAGG + Intronic
1057082498 9:92183511-92183533 GTCCATCTGCAAAGTGAGTACGG - Intergenic
1057847908 9:98539545-98539567 CCCCTTCTACAAAATGAGGAGGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058542196 9:106023100-106023122 ATTCTTCTGTAAAATGAGGTAGG - Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1059330978 9:113535674-113535696 GTCCAACTGCAAAATGAGAAAGG + Intronic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059576680 9:115496875-115496897 CTTTATCTACAAAATGAGAAGGG - Intergenic
1059614256 9:115931794-115931816 CTGCATCTGGAAATAGAGGAAGG + Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1059972243 9:119679641-119679663 ATCCATCTGTGAAATGAGGATGG + Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060471984 9:123955792-123955814 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060839460 9:126782319-126782341 TTTCATCTGTCAAATGAGCACGG - Intergenic
1060884660 9:127142226-127142248 ATACATCTGCAATATGAGGCTGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061017940 9:127993483-127993505 CTTCAACTGTGAAGTGAGGATGG - Intergenic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062099107 9:134718821-134718843 CTGCATCTGTGAAATGGGGATGG + Intronic
1062552456 9:137095874-137095896 AGTCATCTGCAAAGTGAGGCAGG - Intronic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1185943979 X:4353754-4353776 CTTCATCTATAAAGTGGGGATGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186567553 X:10679809-10679831 CTTCACCTACAAAGTGATGAAGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186826823 X:13348819-13348841 ATTTATCTGCAAAATAAGGATGG - Intergenic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187256773 X:17650401-17650423 CTTCATCTATAAAATAAGGAGGG - Intronic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1188128794 X:26404423-26404445 CTTCATTTGTAATATGAGAATGG - Intergenic
1188155776 X:26740792-26740814 CTTCATTAGCAGCATGAGGATGG - Intergenic
1188272547 X:28158455-28158477 CTTCACCTTCAAAACGAGCATGG + Intergenic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1188960988 X:36491159-36491181 CTTCACCTGCTACATGGGGAAGG - Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189300976 X:39952082-39952104 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189546019 X:42043358-42043380 CCTATTCTGAAAAATGAGGATGG - Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190227606 X:48558285-48558307 CATCGTCTGTAAAATGAGAATGG + Intronic
1190287763 X:48971992-48972014 CGTCATCTGGAAAATGGGGGTGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191043860 X:56114594-56114616 GTCCATATGCAATATGAGGACGG - Intergenic
1191149728 X:57208201-57208223 CTTTTTCTTCAAAATAAGGAGGG + Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192554496 X:72079120-72079142 CTACATTGGCAAAATGAGCATGG - Intergenic
1192884659 X:75324024-75324046 CTTTTTCTTCAAAATAAGGAGGG - Intergenic
1193385427 X:80865450-80865472 CTTCATCTGTAAAATGTGAGGGG - Intergenic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1193751226 X:85346831-85346853 TTTCATCTGCAAAATTAGTAGGG - Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194536245 X:95108423-95108445 CTTTTTCTTCAAAATAAGGAGGG + Intergenic
1195195662 X:102495416-102495438 CTTTATCTACACAATGAGGGTGG + Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195655561 X:107328387-107328409 CTTCATATGCCAGATGAGAATGG + Intergenic
1196189225 X:112777590-112777612 AATCATTTGCAAAGTGAGGAAGG - Exonic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197296783 X:124728874-124728896 CTTCATCTCTCAATTGAGGATGG + Intronic
1197806184 X:130400796-130400818 CTTCCTCTACAAAATGAGGGTGG + Intergenic
1197893374 X:131287240-131287262 GTTCATCAGTAAAATGGGGATGG - Intronic
1197918517 X:131562476-131562498 CTTCATCTTTAAAATGAGGGAGG - Intergenic
1197974020 X:132145947-132145969 CTTCGTCTCTAAAATGTGGAAGG - Intergenic
1198039288 X:132833992-132834014 CTGTATCTGCCAAATGAGGATGG - Intronic
1198103068 X:133438590-133438612 CTTCATCTGTAAACTGAAGGTGG - Intergenic
1198103842 X:133444113-133444135 GTTCTTCTGAAAAATGAAGACGG + Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198506878 X:137309718-137309740 CTTCATCTATAAAATAAAGATGG - Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199684597 X:150255017-150255039 CTCCAGCTGAAGAATGAGGATGG + Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1200311092 X:155078114-155078136 CTTCAGCTGCAGACTGAGGCAGG - Intronic