ID: 1131517612

View in Genome Browser
Species Human (GRCh38)
Location 15:93089322-93089344
Sequence CCGCGCGCGCCCCCCGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131517612_1131517623 -3 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517623 15:93089342-93089364 CGGGCGGGGCCGGCAGGGAGGGG No data
1131517612_1131517620 -8 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517620 15:93089337-93089359 GCGCGCGGGCGGGGCCGGCAGGG No data
1131517612_1131517621 -5 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517621 15:93089340-93089362 CGCGGGCGGGGCCGGCAGGGAGG No data
1131517612_1131517632 17 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517632 15:93089362-93089384 GGGCGGGGAGGAGCGGGGTGCGG No data
1131517612_1131517629 10 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517629 15:93089355-93089377 CAGGGAGGGGCGGGGAGGAGCGG No data
1131517612_1131517626 2 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517626 15:93089347-93089369 GGGGCCGGCAGGGAGGGGCGGGG No data
1131517612_1131517624 0 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517624 15:93089345-93089367 GCGGGGCCGGCAGGGAGGGGCGG No data
1131517612_1131517619 -9 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517619 15:93089336-93089358 CGCGCGCGGGCGGGGCCGGCAGG No data
1131517612_1131517633 18 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517633 15:93089363-93089385 GGCGGGGAGGAGCGGGGTGCGGG No data
1131517612_1131517630 11 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517630 15:93089356-93089378 AGGGAGGGGCGGGGAGGAGCGGG No data
1131517612_1131517631 12 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517631 15:93089357-93089379 GGGAGGGGCGGGGAGGAGCGGGG No data
1131517612_1131517627 5 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517627 15:93089350-93089372 GCCGGCAGGGAGGGGCGGGGAGG No data
1131517612_1131517622 -4 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517622 15:93089341-93089363 GCGGGCGGGGCCGGCAGGGAGGG No data
1131517612_1131517625 1 Left 1131517612 15:93089322-93089344 CCGCGGGCGGGGGGCGCGCGCGG No data
Right 1131517625 15:93089346-93089368 CGGGGCCGGCAGGGAGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131517612 Original CRISPR CCGCGCGCGCCCCCCGCCCG CGG (reversed) Intergenic
No off target data available for this crispr