ID: 1131518429

View in Genome Browser
Species Human (GRCh38)
Location 15:93095148-93095170
Sequence CCAGCTCAGCACAGCTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131518429_1131518436 13 Left 1131518429 15:93095148-93095170 CCATTATAGCTGTGCTGAGCTGG No data
Right 1131518436 15:93095184-93095206 TCCATGACCCACAGCATAACAGG No data
1131518429_1131518439 20 Left 1131518429 15:93095148-93095170 CCATTATAGCTGTGCTGAGCTGG No data
Right 1131518439 15:93095191-93095213 CCCACAGCATAACAGGAAGTTGG No data
1131518429_1131518441 21 Left 1131518429 15:93095148-93095170 CCATTATAGCTGTGCTGAGCTGG No data
Right 1131518441 15:93095192-93095214 CCACAGCATAACAGGAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131518429 Original CRISPR CCAGCTCAGCACAGCTATAA TGG (reversed) Intergenic
No off target data available for this crispr