ID: 1131522483

View in Genome Browser
Species Human (GRCh38)
Location 15:93126900-93126922
Sequence CAGTGGACACAGCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131522469_1131522483 25 Left 1131522469 15:93126852-93126874 CCATCATGTCAGATCATCTGGCT No data
Right 1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG No data
1131522472_1131522483 -2 Left 1131522472 15:93126879-93126901 CCTGGCCCTTCCCCACGAGCCCA No data
Right 1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG No data
1131522474_1131522483 -7 Left 1131522474 15:93126884-93126906 CCCTTCCCCACGAGCCCAGTGGA No data
Right 1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG No data
1131522475_1131522483 -8 Left 1131522475 15:93126885-93126907 CCTTCCCCACGAGCCCAGTGGAC No data
Right 1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG No data
1131522467_1131522483 30 Left 1131522467 15:93126847-93126869 CCTTTCCATCATGTCAGATCATC No data
Right 1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131522483 Original CRISPR CAGTGGACACAGCTGGAGCA GGG Intergenic
No off target data available for this crispr