ID: 1131526165

View in Genome Browser
Species Human (GRCh38)
Location 15:93154413-93154435
Sequence CTTCCAAAACAGAGGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131526165_1131526171 23 Left 1131526165 15:93154413-93154435 CCTTGTGCCCTCTGTTTTGGAAG No data
Right 1131526171 15:93154459-93154481 TTCCCTCTGTCATTCGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131526165 Original CRISPR CTTCCAAAACAGAGGGCACA AGG (reversed) Intergenic
No off target data available for this crispr