ID: 1131527097

View in Genome Browser
Species Human (GRCh38)
Location 15:93161168-93161190
Sequence CCGTCTTCACGCTTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131527093_1131527097 -6 Left 1131527093 15:93161151-93161173 CCATAATGAGAAATTTTCCGTCT No data
Right 1131527097 15:93161168-93161190 CCGTCTTCACGCTTGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131527097 Original CRISPR CCGTCTTCACGCTTGTGCTG GGG Intergenic
No off target data available for this crispr