ID: 1131527273

View in Genome Browser
Species Human (GRCh38)
Location 15:93162466-93162488
Sequence CCTTTTAAGTAGTCGGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131527268_1131527273 -3 Left 1131527268 15:93162446-93162468 CCGGACAAAGAAAGCAGCCACCT 0: 7
1: 1
2: 4
3: 20
4: 187
Right 1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG No data
1131527267_1131527273 -2 Left 1131527267 15:93162445-93162467 CCCGGACAAAGAAAGCAGCCACC 0: 11
1: 3
2: 6
3: 34
4: 219
Right 1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG No data
1131527265_1131527273 14 Left 1131527265 15:93162429-93162451 CCAGGAAAGTCTGAGCCCCGGAC No data
Right 1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG No data
1131527266_1131527273 -1 Left 1131527266 15:93162444-93162466 CCCCGGACAAAGAAAGCAGCCAC 0: 7
1: 7
2: 3
3: 12
4: 123
Right 1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG No data
1131527263_1131527273 21 Left 1131527263 15:93162422-93162444 CCAGCATCCAGGAAAGTCTGAGC No data
Right 1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131527273 Original CRISPR CCTTTTAAGTAGTCGGTGGC CGG Intergenic
No off target data available for this crispr