ID: 1131529419

View in Genome Browser
Species Human (GRCh38)
Location 15:93179292-93179314
Sequence GGTCCCTGATGCTTTCCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131529417_1131529419 -4 Left 1131529417 15:93179273-93179295 CCATGAGCACGAGTGACCGGGTC No data
Right 1131529419 15:93179292-93179314 GGTCCCTGATGCTTTCCTCGTGG No data
1131529414_1131529419 22 Left 1131529414 15:93179247-93179269 CCTTTGACTTGGGAGGGGCAGGT No data
Right 1131529419 15:93179292-93179314 GGTCCCTGATGCTTTCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131529419 Original CRISPR GGTCCCTGATGCTTTCCTCG TGG Intergenic
No off target data available for this crispr