ID: 1131542798

View in Genome Browser
Species Human (GRCh38)
Location 15:93288899-93288921
Sequence TCCACAGTGAATGGCAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131542798_1131542811 9 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542811 15:93288931-93288953 GGTGGGGACGGTGCAGTGGGCGG No data
1131542798_1131542810 6 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542810 15:93288928-93288950 GGGGGTGGGGACGGTGCAGTGGG No data
1131542798_1131542816 17 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542816 15:93288939-93288961 CGGTGCAGTGGGCGGGGGTTGGG No data
1131542798_1131542819 26 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542819 15:93288948-93288970 GGGCGGGGGTTGGGGGTGCTTGG No data
1131542798_1131542815 16 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542815 15:93288938-93288960 ACGGTGCAGTGGGCGGGGGTTGG No data
1131542798_1131542813 11 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542813 15:93288933-93288955 TGGGGACGGTGCAGTGGGCGGGG No data
1131542798_1131542806 -8 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542806 15:93288914-93288936 ACTGTGGACAGCTTGGGGGTGGG No data
1131542798_1131542817 18 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542817 15:93288940-93288962 GGTGCAGTGGGCGGGGGTTGGGG No data
1131542798_1131542807 -7 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542807 15:93288915-93288937 CTGTGGACAGCTTGGGGGTGGGG No data
1131542798_1131542805 -9 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542805 15:93288913-93288935 CACTGTGGACAGCTTGGGGGTGG No data
1131542798_1131542814 12 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542814 15:93288934-93288956 GGGGACGGTGCAGTGGGCGGGGG No data
1131542798_1131542809 5 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542809 15:93288927-93288949 TGGGGGTGGGGACGGTGCAGTGG No data
1131542798_1131542812 10 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542812 15:93288932-93288954 GTGGGGACGGTGCAGTGGGCGGG No data
1131542798_1131542808 -3 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542808 15:93288919-93288941 GGACAGCTTGGGGGTGGGGACGG No data
1131542798_1131542818 19 Left 1131542798 15:93288899-93288921 CCCATGCTGCCATTCACTGTGGA No data
Right 1131542818 15:93288941-93288963 GTGCAGTGGGCGGGGGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131542798 Original CRISPR TCCACAGTGAATGGCAGCAT GGG (reversed) Intergenic
No off target data available for this crispr