ID: 1131549110

View in Genome Browser
Species Human (GRCh38)
Location 15:93341541-93341563
Sequence GAAGCATCCTGTACCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131549110_1131549116 29 Left 1131549110 15:93341541-93341563 CCTTCCATGGTACAGGATGCTTC No data
Right 1131549116 15:93341593-93341615 TACTTAGTTTCACCTATGAATGG No data
1131549110_1131549113 1 Left 1131549110 15:93341541-93341563 CCTTCCATGGTACAGGATGCTTC No data
Right 1131549113 15:93341565-93341587 TGAGAAGCAGCTGCTTAGCCAGG No data
1131549110_1131549114 2 Left 1131549110 15:93341541-93341563 CCTTCCATGGTACAGGATGCTTC No data
Right 1131549114 15:93341566-93341588 GAGAAGCAGCTGCTTAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131549110 Original CRISPR GAAGCATCCTGTACCATGGA AGG (reversed) Intergenic
No off target data available for this crispr