ID: 1131556912

View in Genome Browser
Species Human (GRCh38)
Location 15:93407664-93407686
Sequence GTGAGGATACAAAGGCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131556908_1131556912 7 Left 1131556908 15:93407634-93407656 CCTTCCAGGTAGAGGGCATACTC No data
Right 1131556912 15:93407664-93407686 GTGAGGATACAAAGGCATCCTGG No data
1131556904_1131556912 26 Left 1131556904 15:93407615-93407637 CCAGGTGGATGAGTAGGAACCTT No data
Right 1131556912 15:93407664-93407686 GTGAGGATACAAAGGCATCCTGG No data
1131556909_1131556912 3 Left 1131556909 15:93407638-93407660 CCAGGTAGAGGGCATACTCAGTC No data
Right 1131556912 15:93407664-93407686 GTGAGGATACAAAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131556912 Original CRISPR GTGAGGATACAAAGGCATCC TGG Intergenic
No off target data available for this crispr