ID: 1131558182

View in Genome Browser
Species Human (GRCh38)
Location 15:93417374-93417396
Sequence AGGCCAGGCCGAGCTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131558174_1131558182 8 Left 1131558174 15:93417343-93417365 CCTCCACGTTGGAAGAAACGCCC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1131558182 15:93417374-93417396 AGGCCAGGCCGAGCTCCCACAGG 0: 1
1: 0
2: 0
3: 29
4: 214
1131558175_1131558182 5 Left 1131558175 15:93417346-93417368 CCACGTTGGAAGAAACGCCCATG 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1131558182 15:93417374-93417396 AGGCCAGGCCGAGCTCCCACAGG 0: 1
1: 0
2: 0
3: 29
4: 214
1131558172_1131558182 19 Left 1131558172 15:93417332-93417354 CCACTGACAAACCTCCACGTTGG 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1131558182 15:93417374-93417396 AGGCCAGGCCGAGCTCCCACAGG 0: 1
1: 0
2: 0
3: 29
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131558182 Original CRISPR AGGCCAGGCCGAGCTCCCAC AGG Intergenic
900032077 1:379422-379444 AGGCCAGGCTCAGCCCCCAGTGG + Intergenic
900052626 1:607608-607630 AGGCCAGGCTCAGCCCCCAGTGG + Intergenic
900126294 1:1070327-1070349 AGGCCAGGTCCAGCTCACGCAGG - Intergenic
900176196 1:1292459-1292481 AGGCGGGGCCAAGCTCACACAGG + Exonic
900236553 1:1594384-1594406 GGGCCAGGACGCGCCCCCACGGG + Intergenic
900318682 1:2071766-2071788 TGGCCACGCTGAGCTCCCACAGG - Intronic
900382417 1:2391495-2391517 AGGGCACCCCGAGCTCCCGCGGG - Exonic
900415459 1:2532573-2532595 AGGCCAGGCCCTGCTCCCGCAGG + Intergenic
900605379 1:3521420-3521442 GGCCCAGGCCGAGCTGCCGCAGG + Intronic
900738948 1:4318891-4318913 AGGCCAGGCGGGCCTCCCCCAGG - Intergenic
902032085 1:13430521-13430543 AGGCCAGAGCCAGCTCCCTCTGG + Intergenic
903006665 1:20303272-20303294 AGGCCTGGCTGAGCCCACACAGG + Intronic
903808588 1:26022191-26022213 GGACCAGTCAGAGCTCCCACAGG - Exonic
904034019 1:27549625-27549647 AGGCCAGACCGAGCTCAGCCAGG - Exonic
904473310 1:30748866-30748888 TGGCCAGGCCAGGATCCCACAGG - Intronic
904747683 1:32720962-32720984 AGGCCAGGCCTCCCTCTCACTGG - Intergenic
905348455 1:37327813-37327835 AGGCCAGGCCCTCCTCCCTCTGG + Intergenic
905774483 1:40659862-40659884 AGGCAAGGACCAGATCCCACAGG + Intronic
905861338 1:41354001-41354023 AGGCCATGCCTAGCACCCAGAGG + Intergenic
905875155 1:41427554-41427576 AGGTCAAGCCGAGCTCCTAGCGG + Intergenic
912547065 1:110458407-110458429 AAGCCAGGCCAGGCCCCCACAGG + Intergenic
914198068 1:145460559-145460581 CGCCCCGGCCGAGCTCCCTCAGG + Intergenic
914477170 1:148033691-148033713 CGCCCCGGCCGAGCTCCCTCAGG + Intergenic
915604348 1:156941331-156941353 AGGCCTGGGCTGGCTCCCACAGG + Intronic
916436560 1:164783104-164783126 TGGCCTGGCAGAGCTCACACTGG - Intronic
916890923 1:169111664-169111686 ATTGCAGGCAGAGCTCCCACGGG + Intronic
918462655 1:184792477-184792499 AGCCCAGGCTGACCTCACACCGG - Exonic
918896899 1:190359647-190359669 AGGTATGGCCAAGCTCCCACAGG - Intronic
919664363 1:200278167-200278189 AGGCCAGGCCTCGCTCGCAAAGG + Intergenic
919811326 1:201410597-201410619 AGGCCAAGCCGAGGCCCCACAGG + Intronic
920898975 1:210087499-210087521 AGGCCAGGCTGCCCTCCCATGGG + Intronic
922730537 1:227946905-227946927 AGGCCAGCCAGGGCTCCCAGCGG + Intronic
923007986 1:230067319-230067341 AGGCGATGCCCAGCACCCACAGG - Exonic
1062805671 10:417849-417871 AGGCCTGTCCGAGCTCTGACAGG - Intronic
1062805734 10:418108-418130 AGGCCTATCCGAGCTCCGACAGG - Intronic
1062805742 10:418146-418168 AGGCCTGTCCGAGCTCTGACAGG - Intronic
1062805776 10:418291-418313 AGGCCTATCCGAGCTCCGACAGG - Intronic
1062975162 10:1677580-1677602 AGGCCAGGAGGAGCTCCACCTGG - Intronic
1064155964 10:12903499-12903521 AGGCCAGGCCAAGCTGAAACAGG + Intronic
1064436415 10:15314852-15314874 AGGCCAGGCCGAGGTGGCAGGGG - Intronic
1067053750 10:43039740-43039762 GGGCCAGGCCCAGCTGCCTCAGG + Intergenic
1070801198 10:79245324-79245346 AGGCCAGGCCTGGCTCCAACAGG + Intronic
1070932967 10:80273756-80273778 AGACCAGGCCCAGCTCCCCCTGG + Exonic
1073288637 10:102402686-102402708 AAGCCAGGCCGTGCTGCCCCCGG + Exonic
1075630228 10:123996050-123996072 AGGCCAGACCGAGCTGCTGCAGG - Intergenic
1075786365 10:125052799-125052821 AGCCCAGACGGAGCGCCCACTGG + Intronic
1077036618 11:498536-498558 CGGCCAGGCTGAGCTCCTTCAGG + Exonic
1077356884 11:2122807-2122829 AGGCCAGGGCTGGCACCCACAGG - Intergenic
1077430047 11:2511853-2511875 AGGCCAGGCCGGGCTCCACAGGG - Intronic
1081614895 11:44584989-44585011 TGGGCAGACCGAGCTCCCACGGG + Intronic
1083827521 11:65211826-65211848 AGGGAAGGCCGACCGCCCACAGG - Exonic
1084966450 11:72747100-72747122 GGGCCAGCCCAAGCTCCCCCAGG + Intronic
1085052386 11:73386516-73386538 AGCCCAGACTGAGCCCCCACTGG - Intronic
1086552472 11:88069092-88069114 GGGCCAGGGCGAGCTCCCGGTGG + Intergenic
1087386961 11:97483486-97483508 AGGCCTGGCCCAACCCCCACAGG + Intergenic
1092256412 12:6928528-6928550 AGGCCAGGCAGAGCCCGCAGTGG - Intronic
1092779017 12:11968172-11968194 AGACGAGGCTGACCTCCCACAGG + Intergenic
1096215716 12:49796592-49796614 TGGCCAGGCCGAGAGCCCAGTGG + Exonic
1098767954 12:74514201-74514223 AGCCCAGGCAGAGGTGCCACGGG - Intergenic
1101600554 12:106205861-106205883 TGGGCAGGGCCAGCTCCCACAGG - Intergenic
1101996002 12:109525204-109525226 AGGCCACGCAGGGCTCCCAGCGG - Intronic
1103745611 12:123121147-123121169 AGGCCTGGCCAAGCTCTCACCGG + Intronic
1103901885 12:124307614-124307636 AGGCCAGGCTGGGGACCCACGGG + Intronic
1103989179 12:124786735-124786757 AGGCCAGGTCCACCTCCCATTGG - Intronic
1104961114 12:132489262-132489284 AGGACAGGCCGAGCTCGGAGGGG - Intergenic
1105016399 12:132788534-132788556 AGCCCAGGCTCAGCTTCCACAGG + Intronic
1106075857 13:26460642-26460664 AGAACAGGCCGAGTTCCCAAAGG + Intergenic
1106393189 13:29355544-29355566 AGGCCTGGCCAGGCTCCTACAGG + Intronic
1111858304 13:93668725-93668747 AGGCAAGGCTGAGCTCCCTCAGG - Intronic
1113981871 13:114282564-114282586 AGGCCAGGGCGCACTCCCAGAGG - Intronic
1118775014 14:68968373-68968395 AGGGATGGCAGAGCTCCCACAGG + Intronic
1119429611 14:74557898-74557920 CTTCCAGGCTGAGCTCCCACTGG - Intronic
1120268157 14:82277246-82277268 GGGCCAGGCCCAGGTCCCTCAGG + Intergenic
1121020254 14:90575581-90575603 AGGGCAGGCCCCCCTCCCACTGG - Intronic
1122408631 14:101514722-101514744 GGGCAAGGGCGAGCTCACACTGG + Intergenic
1123758760 15:23416894-23416916 AGGCCTCGCGGAGCTCTCACTGG - Intergenic
1124421512 15:29527107-29527129 AGAGCAGGCTGAGCTGCCACAGG - Intronic
1127995742 15:64152330-64152352 AGGCGGCGCCGACCTCCCACCGG + Intronic
1128247519 15:66143326-66143348 CGGCCTGGCCTAGCCCCCACCGG - Intronic
1129742171 15:77994572-77994594 AGCTCAGGCCCAGCTGCCACTGG - Intronic
1129843310 15:78756908-78756930 AGCTCAGGCCCAGCTGCCACTGG + Intergenic
1130138035 15:81197908-81197930 AGGCCAGTTCAAGCTCCCACTGG + Intronic
1131558182 15:93417374-93417396 AGGCCAGGCCGAGCTCCCACAGG + Intergenic
1132557791 16:580052-580074 AGGCCATCCCGAGTTCCCTCAGG + Intronic
1132840869 16:1977997-1978019 TGGCCAGGCCCAGCGCCCGCAGG - Exonic
1133090644 16:3401329-3401351 TCGCCAGTCCGAGCTCACACCGG + Intronic
1133311192 16:4847729-4847751 AGGCCGCGCCGAGCTCCGTCAGG - Intronic
1133321313 16:4915292-4915314 AGGCCAGGCCCAAGGCCCACTGG + Intronic
1134089536 16:11384221-11384243 AGGCCAGGCTGAGCTCCTCCAGG + Exonic
1134914079 16:18054542-18054564 TGGCCATGCTGAGCTCCCGCAGG - Intergenic
1138304900 16:55965625-55965647 AGACCCAGCCAAGCTCCCACAGG - Intergenic
1139840356 16:69873554-69873576 AGGCCAGGCTCAGCTACCACCGG - Intronic
1140950473 16:79812284-79812306 AGTCCAGAGGGAGCTCCCACAGG + Intergenic
1141901525 16:86994181-86994203 ACGCCTTGCCGAGCTCCCACGGG + Intergenic
1142376489 16:89709449-89709471 AGGCCAGGCTAAGCTGCCCCAGG + Intronic
1142858626 17:2748052-2748074 ACGCCAGGACGAGCACCCAGTGG - Intergenic
1143010146 17:3861783-3861805 AGGCCTGGCTCAGCTGCCACAGG - Intronic
1143508233 17:7381186-7381208 AGGACAGGCCCAGCGCCCCCCGG - Intronic
1145998930 17:29120136-29120158 AAGACAGGCCCAGCTCCCAAAGG + Intronic
1147388758 17:40096813-40096835 AGGCCAGGCTGAGTGGCCACAGG + Intronic
1148340854 17:46872643-46872665 CAGCCAGGCCGGGCTCCCTCCGG - Exonic
1148786951 17:50150258-50150280 GGGCCTGGCCGAGGCCCCACGGG - Exonic
1149866708 17:60155068-60155090 GGGCCAGGCCAAGCAGCCACTGG - Intronic
1150458845 17:65330409-65330431 AGGCCTCGCCAGGCTCCCACAGG + Intergenic
1151305553 17:73260848-73260870 AGGCCAGGCAGAGCCCCTGCTGG + Intronic
1151419456 17:73987622-73987644 AGGCCAGGACGGGCTCCTCCAGG - Intergenic
1151944383 17:77311494-77311516 AGCCCAGGCCTTGCCCCCACAGG - Intronic
1152283967 17:79401842-79401864 AGGCAGGGCCGCGCTCCCTCGGG - Intronic
1152356599 17:79810533-79810555 AGGACAGGCCAAGCGGCCACGGG - Intergenic
1152517156 17:80832307-80832329 TGGCCAGCACGAGCTTCCACGGG - Intronic
1152684668 17:81688190-81688212 AGGCCAGGCTGCGCTCTAACCGG + Intronic
1152947579 17:83206294-83206316 AGGCCAGGCTCAGCCCCCAGTGG - Intergenic
1157577463 18:48753092-48753114 AGGGCAGGCAGAGCTCACTCAGG + Intronic
1160629770 18:80238792-80238814 AGGCAAGGCTGAACTTCCACTGG + Intronic
1160818977 19:1049354-1049376 AGTCCAGGCTGAGCCCCCGCAGG - Exonic
1160897696 19:1410377-1410399 AGGACAGGCCCCGCTCCCAAAGG - Intronic
1160912694 19:1482163-1482185 AGGCCAGGCAGAGCTGTCCCAGG + Exonic
1161133372 19:2605039-2605061 GGGCAAGGCCGTGCTCCCTCTGG + Intronic
1161268490 19:3376020-3376042 AGACCTGGCTGAGGTCCCACAGG - Intronic
1161405392 19:4088538-4088560 AGGACCGGCCGAGGTCCCGCCGG + Intergenic
1161574061 19:5046183-5046205 AGCCCAGGCCGACCTGCCACAGG + Intronic
1162931312 19:13959275-13959297 AGGGCAGGCCGGGCTTCCTCAGG - Exonic
926043265 2:9691629-9691651 AGCCCAGGCCTGGCTGCCACTGG + Intergenic
927510933 2:23643168-23643190 AGGCCAGGCCAAGCTGCAAAAGG + Intronic
927680572 2:25136461-25136483 AGGCCAGCCTGAGCTCACACGGG - Intronic
928083120 2:28327304-28327326 AGGCCAGGACTTGCTCCCACGGG - Exonic
929491293 2:42398897-42398919 TGCCCAGGCAGAGCTCCCAGTGG - Intronic
929969688 2:46563459-46563481 AGGCCGGGAAGAGCCCCCACGGG + Intronic
931632210 2:64311495-64311517 AGGTCAGGCCCAGCTCTCAGGGG + Intergenic
933139777 2:78779036-78779058 AGGCCAGCGCGAGCTCCCGGTGG + Intergenic
933733908 2:85479713-85479735 TGGCAAGGCCGTGCTCCCTCTGG - Intergenic
933892417 2:86783981-86784003 AGCCCAGGCCCTGCTTCCACAGG + Intergenic
934648272 2:96071885-96071907 ATGCCAGGCCGGGATCTCACAGG - Intergenic
934780944 2:96969310-96969332 AGGACAGGCCCTGATCCCACAGG + Intronic
936051249 2:109225460-109225482 AGGCCAGGCCGACTCCCCACTGG + Intronic
936281808 2:111147902-111147924 AGGCCATGCCCTGCTCCCACGGG - Intronic
936447135 2:112605212-112605234 AGGCCAGGCCAAGTTCCTACTGG - Intergenic
937288001 2:120765246-120765268 AGTCCAGTCCTAGCTGCCACTGG + Intronic
1168829916 20:840277-840299 AGTCCTGGCCCAGCTCCCACAGG + Intronic
1172090689 20:32429989-32430011 TGGCCAGGCCGAGGTCACCCAGG + Exonic
1172143775 20:32742796-32742818 AGCCCAGGCCAAGCTTCCCCGGG + Intronic
1172442531 20:34976345-34976367 AGGCCAGACCAGGCTCACACGGG - Intronic
1172510589 20:35498105-35498127 AAGCCAGGCCTGGCTCCCAGGGG + Intronic
1172650242 20:36497405-36497427 AGGCCAGTCCCGCCTCCCACGGG - Intronic
1172759834 20:37314253-37314275 AGGCCCGGCCCTCCTCCCACTGG - Intronic
1173666568 20:44767327-44767349 AGGCCAGGCCCATCTCACCCAGG - Intronic
1173894684 20:46541819-46541841 AGGTGAGGCGGAGCTCCCATTGG + Exonic
1175156462 20:56974977-56974999 AAGCCAAGCCCAGCTTCCACTGG - Intergenic
1175171581 20:57084973-57084995 AGGCCAGGCTGGGCCCCAACAGG + Intergenic
1175829172 20:61952688-61952710 CGGCAAGGCTGAGCTCCCTCCGG + Intergenic
1175861232 20:62151433-62151455 GGGCCAAGCCCAGCACCCACAGG - Intronic
1175894881 20:62331581-62331603 GGGCCAGGCCCAGCTCTCCCAGG + Intronic
1176416554 21:6478826-6478848 ACGCCAGGGAGAGCTCTCACAGG - Intergenic
1178817178 21:35942156-35942178 AGGCCAGGCTGAGCCCACAAAGG + Intronic
1179177805 21:39021586-39021608 CGCCCAGGCCCAGCTCCAACAGG - Intergenic
1179692054 21:43087161-43087183 ACGCCAGGGAGAGCTCTCACAGG - Intergenic
1181256218 22:21564479-21564501 AGGCCAGGCAGCCCTTCCACTGG + Intronic
1182322150 22:29484809-29484831 AGGCAAGGCCCTGCTCCCACTGG + Intronic
1182524792 22:30908288-30908310 GGGCCAGCCCCAGATCCCACAGG - Intergenic
1183282124 22:36937626-36937648 GGGCCAGCCGGAGCCCCCACAGG + Exonic
1183499882 22:38172629-38172651 AGGCCAGGCCTGAGTCCCACAGG - Intronic
1184418167 22:44364056-44364078 AGGTCAGGGCGAGCCCCCCCAGG - Intergenic
1184430640 22:44439966-44439988 AGGCCAGACCTTGCTCCCAGGGG - Intergenic
1185012933 22:48325883-48325905 CGGCCTGGCCGTGCTCCCTCCGG - Intergenic
1185070278 22:48652296-48652318 TGGCCAGGCTGAGCACCAACTGG - Intronic
1185179363 22:49350258-49350280 AGCCCCTGCCCAGCTCCCACAGG - Intergenic
949534752 3:4987095-4987117 AGGCCTTGCCGAGCTTCCCCGGG - Intergenic
950161626 3:10764823-10764845 GGGCCAGGCCGAGCTCCCCAAGG - Intergenic
950447318 3:13045763-13045785 AGGCCAGGCTCAGCCCCTACAGG + Intronic
950665084 3:14490425-14490447 AGGCCAGGGCCAGGCCCCACTGG - Exonic
952158085 3:30665627-30665649 AAGCCAGGCAGATCTCCCATTGG + Intronic
952822445 3:37496783-37496805 AGGACATGCCGGACTCCCACTGG + Intronic
952885604 3:38009578-38009600 AGACAAGGCAGACCTCCCACGGG + Intronic
953636300 3:44668091-44668113 AGGCCAGGCCCAGGTCCGAGAGG + Intergenic
954291551 3:49652627-49652649 AGGCCCGGCACCGCTCCCACGGG + Exonic
961932347 3:130547379-130547401 AGGCCAGTGCGAGTTCCCAGTGG - Intergenic
962342464 3:134596936-134596958 AGGCCAGGCAGGGCTTCCTCAGG + Intergenic
967434921 3:189432245-189432267 ATGGCAGGCAGAGGTCCCACTGG - Intergenic
967837571 3:193977669-193977691 AGGGCAGTCCGAGCTCACACAGG - Intergenic
968521408 4:1036229-1036251 AGGCCAGGCCAATCCCCCATGGG - Intergenic
969021699 4:4143532-4143554 GGGCCAGGCCGGGGTCCCGCGGG + Intergenic
970665682 4:18333687-18333709 AGGCCACACAGAGTTCCCACTGG - Intergenic
985688721 5:1295266-1295288 GGGCCAGGCCGGGCTCCCAGTGG - Intergenic
989467123 5:41769663-41769685 AGGCCATGCTGAGCAGCCACTGG + Intronic
991986437 5:72291795-72291817 AGGCCAGACCATGCTGCCACAGG - Intronic
992690613 5:79236961-79236983 CGCCCAGGCCGAGCTCCGCCGGG - Exonic
993879743 5:93348330-93348352 AGGGCAGGGCTGGCTCCCACAGG - Intergenic
995282930 5:110355824-110355846 AGGCAAGGCCCAGCTCCCTTAGG + Intronic
1001261596 5:170233721-170233743 TGGCCTGGCCGAGCTCCCCGGGG + Exonic
1002059230 5:176616659-176616681 AGGCCAGGCCGAGCCCAGGCAGG - Intergenic
1002368117 5:178729232-178729254 CGGCCAGGCCCAGGCCCCACAGG + Intronic
1002385209 5:178860816-178860838 CGGCCAGGCCCAGGCCCCACAGG - Intronic
1002741743 5:181439446-181439468 AGGCCAGGCTCAGCCCCCAGTGG - Intergenic
1003114794 6:3276654-3276676 TGGCTCAGCCGAGCTCCCACAGG + Intronic
1004011522 6:11692928-11692950 AGGCCAGGGATAGCTCCCAGGGG - Intergenic
1006436790 6:34029870-34029892 AGGTCAGGCAGAGCTCCGAGGGG + Intronic
1006802484 6:36768041-36768063 AGGCCAGGCCGAGTTTGCACAGG - Intronic
1007217718 6:40253459-40253481 AGCCCAGGCCAAGCTTTCACAGG - Intergenic
1007405802 6:41635551-41635573 AGCCCAGGCCCAGCTTCCCCGGG - Intergenic
1007497193 6:42268319-42268341 AGGCCATGCTGAGCTCCCATGGG - Exonic
1008631159 6:53363769-53363791 AGGCCAGTGCGAGTTCCCAGTGG - Intergenic
1015485586 6:133766375-133766397 AAGCCATTCCCAGCTCCCACAGG - Intergenic
1017889387 6:158626229-158626251 AGGCCAGGCCGAGCCTGCCCTGG - Intronic
1018656452 6:166041537-166041559 AGGCCAGTAAGAGCCCCCACCGG - Intergenic
1019211009 6:170404850-170404872 AAGCGAGGCCTGGCTCCCACAGG - Exonic
1019246883 6:170715203-170715225 AGGCCAGGCTCAGCCCCCAGTGG - Intergenic
1019479678 7:1260672-1260694 AGGCCAGGCCGGGCACCCGCAGG - Intergenic
1023519440 7:41035772-41035794 TGGCCAGAGTGAGCTCCCACAGG - Intergenic
1024180798 7:46892989-46893011 AGGCCTGGCTGAGATGCCACAGG + Intergenic
1026332822 7:69367732-69367754 AGGCCATGCCGGGCTGACACAGG + Intergenic
1026737322 7:72957295-72957317 TGGCAAGGCCGCGCTCCCTCTGG - Intergenic
1026787524 7:73311293-73311315 CGGCAAGGCCGCGCTCCCTCTGG - Intergenic
1027106410 7:75407773-75407795 CGGCAAGGCCGCGCTCCCTCTGG + Intronic
1027468095 7:78540217-78540239 AGGACAGGCTGAGCTCAGACAGG - Intronic
1029453568 7:100655996-100656018 ACTCCAGGCCCAGCTCCCACCGG - Intronic
1029698326 7:102229213-102229235 AACCCAGGCCGAGCACCCAGGGG - Intronic
1029707612 7:102284024-102284046 AGGCCAGCCCCAGCTCCCAGGGG - Intergenic
1029834889 7:103298412-103298434 AGGCCAGGCAGAGATCTCAGTGG + Intronic
1033347227 7:140534870-140534892 AGGCCCAGCCAACCTCCCACTGG - Intronic
1034981970 7:155484830-155484852 CAGCAACGCCGAGCTCCCACTGG + Intronic
1035501258 8:92750-92772 AGGCCAGGCTCAGCCCCCAGTGG + Intergenic
1040543425 8:48379572-48379594 AGGCCAGACAGAGCACCTACCGG - Intergenic
1047411446 8:124627749-124627771 AGGTCAGCCTGAGCTTCCACAGG + Intronic
1049326460 8:142023967-142023989 ACCCCAGGACGAGCTCCCAGAGG - Intergenic
1049795387 8:144494986-144495008 AGGCCAGGGCAAGCACACACTGG - Intronic
1049815656 8:144598116-144598138 AGGCCATGCCGGGCGCCCTCTGG - Intronic
1052834446 9:33240220-33240242 AGGCCAGGGCGATTACCCACTGG - Exonic
1056506276 9:87261161-87261183 AGGCCTGGCCGAGCTACCCCAGG + Intergenic
1057139969 9:92720422-92720444 CGGCCTGGCCAAGCTGCCACTGG - Exonic
1061295564 9:129675089-129675111 AGGCCGGGCAGAGCTGCCGCAGG + Intronic
1061925871 9:133805856-133805878 TGCCCCTGCCGAGCTCCCACAGG + Intronic
1062006131 9:134239456-134239478 AGGCCAAGAGGGGCTCCCACTGG - Intergenic
1062660422 9:137628487-137628509 TGCCCAGGCCGATCTCCAACTGG + Intronic
1203607655 Un_KI270748v1:70662-70684 AGGCCAGGCTCAGCCCCCAGTGG - Intergenic
1186154963 X:6715891-6715913 AAGCCAGGCTGAGCTGCCAAAGG + Intergenic
1189294299 X:39908081-39908103 AGGCCTTGCTAAGCTCCCACTGG - Intergenic
1190437712 X:50442907-50442929 AGGCCATGCTTAGCTCCTACAGG + Intronic
1190980962 X:55456382-55456404 AGGCCAGGCCGAGTTTACAGAGG + Intergenic
1190987735 X:55516798-55516820 AGGCCAGGCCGAGTTTACAGAGG - Intergenic
1197089591 X:122521070-122521092 AGCCCACACAGAGCTCCCACTGG - Intergenic
1200051621 X:153434997-153435019 ATGCCAGCCCGTGCTCCCAGTGG + Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200976620 Y:9218386-9218408 AGGCCTTGCCAGGCTCCCACAGG + Intergenic
1202134550 Y:21648166-21648188 AGGCCTTGCCAGGCTCCCACAGG - Intergenic