ID: 1131558673

View in Genome Browser
Species Human (GRCh38)
Location 15:93420665-93420687
Sequence CTGGCAGGTGACAGGGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131558661_1131558673 30 Left 1131558661 15:93420612-93420634 CCACTGGAGAGCTTGTCATGGCG No data
Right 1131558673 15:93420665-93420687 CTGGCAGGTGACAGGGTTGGAGG No data
1131558666_1131558673 -3 Left 1131558666 15:93420645-93420667 CCGGGCTTTCCTGAGACGCTCTG No data
Right 1131558673 15:93420665-93420687 CTGGCAGGTGACAGGGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131558673 Original CRISPR CTGGCAGGTGACAGGGTTGG AGG Intergenic
No off target data available for this crispr