ID: 1131562915

View in Genome Browser
Species Human (GRCh38)
Location 15:93459809-93459831
Sequence ACCTTATATGGCGGCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131562909_1131562915 28 Left 1131562909 15:93459758-93459780 CCATCATTGATAGCTTGCTTTTT No data
Right 1131562915 15:93459809-93459831 ACCTTATATGGCGGCTGCTGAGG No data
1131562912_1131562915 -9 Left 1131562912 15:93459795-93459817 CCTGGTAAGGTAGCACCTTATAT No data
Right 1131562915 15:93459809-93459831 ACCTTATATGGCGGCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131562915 Original CRISPR ACCTTATATGGCGGCTGCTG AGG Intergenic
No off target data available for this crispr