ID: 1131571949

View in Genome Browser
Species Human (GRCh38)
Location 15:93546795-93546817
Sequence CTATTATTCCTCTTCTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131571949_1131571952 9 Left 1131571949 15:93546795-93546817 CCCATACAGAAGAGGAATAATAG No data
Right 1131571952 15:93546827-93546849 TTGGACAGCACCAATGACTATGG No data
1131571949_1131571951 -10 Left 1131571949 15:93546795-93546817 CCCATACAGAAGAGGAATAATAG No data
Right 1131571951 15:93546808-93546830 GGAATAATAGAAATATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131571949 Original CRISPR CTATTATTCCTCTTCTGTAT GGG (reversed) Intergenic
No off target data available for this crispr