ID: 1131571954

View in Genome Browser
Species Human (GRCh38)
Location 15:93546881-93546903
Sequence GTTTATCTATAAATGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131571954_1131571958 29 Left 1131571954 15:93546881-93546903 CCTCTCTCCATTTATAGATAAAC No data
Right 1131571958 15:93546933-93546955 TCTCAGTACTTTTTGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131571954 Original CRISPR GTTTATCTATAAATGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr