ID: 1131575721

View in Genome Browser
Species Human (GRCh38)
Location 15:93588708-93588730
Sequence TAAGAGCCCAGGCAGCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131575719_1131575721 -1 Left 1131575719 15:93588686-93588708 CCATCTGTGACTCTATAGGTTAT No data
Right 1131575721 15:93588708-93588730 TAAGAGCCCAGGCAGCATGTAGG No data
1131575718_1131575721 0 Left 1131575718 15:93588685-93588707 CCCATCTGTGACTCTATAGGTTA No data
Right 1131575721 15:93588708-93588730 TAAGAGCCCAGGCAGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131575721 Original CRISPR TAAGAGCCCAGGCAGCATGT AGG Intergenic
No off target data available for this crispr