ID: 1131576800

View in Genome Browser
Species Human (GRCh38)
Location 15:93600492-93600514
Sequence TCCAAAGATGAAGTGTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131576800_1131576803 -3 Left 1131576800 15:93600492-93600514 CCATTGGACACTTCATCTTTGGA No data
Right 1131576803 15:93600512-93600534 GGAAAAGGGTTGACTGATAAAGG No data
1131576800_1131576804 22 Left 1131576800 15:93600492-93600514 CCATTGGACACTTCATCTTTGGA No data
Right 1131576804 15:93600537-93600559 ATGTTTAAACCTAAGCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131576800 Original CRISPR TCCAAAGATGAAGTGTCCAA TGG (reversed) Intergenic
No off target data available for this crispr