ID: 1131594257

View in Genome Browser
Species Human (GRCh38)
Location 15:93781046-93781068
Sequence CTCCGAGGTCAGTCAGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131594257_1131594260 20 Left 1131594257 15:93781046-93781068 CCCTGGTCTGACTGACCTCGGAG No data
Right 1131594260 15:93781089-93781111 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131594257 Original CRISPR CTCCGAGGTCAGTCAGACCA GGG (reversed) Intergenic
No off target data available for this crispr