ID: 1131596568

View in Genome Browser
Species Human (GRCh38)
Location 15:93803915-93803937
Sequence GTGCGTGCACGTGGTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131596561_1131596568 17 Left 1131596561 15:93803875-93803897 CCTAGAGCCTTATTTTTCAATGC No data
Right 1131596568 15:93803915-93803937 GTGCGTGCACGTGGTGGTGGGGG No data
1131596560_1131596568 27 Left 1131596560 15:93803865-93803887 CCTTATGAAACCTAGAGCCTTAT No data
Right 1131596568 15:93803915-93803937 GTGCGTGCACGTGGTGGTGGGGG No data
1131596562_1131596568 10 Left 1131596562 15:93803882-93803904 CCTTATTTTTCAATGCACTCTGT No data
Right 1131596568 15:93803915-93803937 GTGCGTGCACGTGGTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131596568 Original CRISPR GTGCGTGCACGTGGTGGTGG GGG Intergenic