ID: 1131600011

View in Genome Browser
Species Human (GRCh38)
Location 15:93837646-93837668
Sequence CTCTTCCAATTTAAGACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131600011_1131600014 -6 Left 1131600011 15:93837646-93837668 CCTGAGGTCTTAAATTGGAAGAG 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1131600014 15:93837663-93837685 GAAGAGCAACCAGGGCTCACAGG 0: 1
1: 0
2: 3
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131600011 Original CRISPR CTCTTCCAATTTAAGACCTC AGG (reversed) Intergenic
903471018 1:23587564-23587586 TCCTTCCAATTTCATACCTCTGG + Intronic
904776272 1:32908983-32909005 GTCTTCCAATTTATGAACTTAGG - Intergenic
908543665 1:65145269-65145291 CTCTGCCAATGTATGACCTTTGG - Intergenic
908876191 1:68679555-68679577 TTCTTCCAATTTATGAACACAGG + Intergenic
911391010 1:97243160-97243182 CTCTTCCAATTCAAAATCTGGGG + Intronic
911662470 1:100517395-100517417 TTCTTCCAATTAAATACCTGAGG - Intronic
912612828 1:111066205-111066227 CTCTTCCCATTTAGGGCCACGGG - Intergenic
917704161 1:177614619-177614641 ATCTTCCAATTTATGAACACAGG - Intergenic
917729397 1:177859372-177859394 CTCTCCCAATTTAAAAAATCAGG - Intergenic
918227715 1:182500614-182500636 ATCTTCCAATTTATGAACACAGG + Intronic
918331317 1:183463709-183463731 CTCTTTCAAACTAACACCTCTGG - Intergenic
918932052 1:190866475-190866497 CTCTTCAAATTTCAAACCCCTGG - Intergenic
924336192 1:242988975-242988997 CTCTTTCACTTTATGACTTCAGG - Intergenic
924437704 1:244057878-244057900 GTCTTCCAAATTAAAACATCCGG - Intergenic
924477489 1:244394833-244394855 ATCTTCCTCTTGAAGACCTCTGG + Intergenic
924701137 1:246453969-246453991 CTATTCCACTTTAAGGCCTAAGG + Intronic
1065518482 10:26548467-26548489 TTCTTCCAATTTATGAACACGGG + Intronic
1065628263 10:27653285-27653307 TTCTTCCACTTCCAGACCTCTGG + Intergenic
1067183752 10:44009732-44009754 CTCTTTCTATTTTAGTCCTCAGG + Intergenic
1069503244 10:68973391-68973413 CACTTCAATTTAAAGACCTCTGG - Intronic
1072096552 10:92187192-92187214 CTCTTCCATTTTAACACCAAAGG + Intronic
1073513637 10:104058212-104058234 CTCCTCCAGTTTAAAAGCTCAGG - Intronic
1075385749 10:122054152-122054174 CTCTTCCTATTGAAGAACTTTGG - Intronic
1076276338 10:129202252-129202274 CTCTTCCAATTATAGAGCACAGG + Intergenic
1079653147 11:22956222-22956244 CTTTTCCCATTTAACAGCTCTGG - Intergenic
1080522237 11:33077331-33077353 CTCTGGCAATGTAAGAACTCAGG - Intronic
1082062597 11:47873403-47873425 TTCTTTCTATTTAAGACTTCTGG - Intergenic
1083427202 11:62594362-62594384 CTCTGCCAATGGAAGGCCTCTGG - Exonic
1083735021 11:64675269-64675291 CCTCCCCAATTTAAGACCTCAGG - Intronic
1086127881 11:83368345-83368367 CCCTTCCAATTTAGGCCCACTGG + Intergenic
1087783040 11:102321324-102321346 GTCTTCCAGTTTGAAACCTCTGG + Intronic
1087986740 11:104691698-104691720 CTCTTCCCATTTTTGACCTTGGG - Intergenic
1088185983 11:107170680-107170702 CTGATCAAATTTAAGACCTCAGG - Intergenic
1088395237 11:109360865-109360887 CTCTGCCAATTTATGACCTTGGG - Intergenic
1089665656 11:120016853-120016875 CTCTCCCAATGTAAGATCCCAGG + Intergenic
1090451531 11:126810664-126810686 CTCTTCAATGTAAAGACCTCTGG - Intronic
1090552334 11:127836410-127836432 CTCTTCCACAGTAAGAACTCTGG - Intergenic
1093484524 12:19639080-19639102 CTCTTCCTATTCATGACCTTTGG - Intronic
1095431612 12:42140376-42140398 TTCTTCCAATTTCTGACCTCTGG - Intronic
1095978317 12:47954886-47954908 CTCTTCCAACTTCAGCCCTCGGG - Intergenic
1097908379 12:64943980-64944002 CTTTTCCTGTTTATGACCTCAGG + Intergenic
1098214049 12:68197016-68197038 CTCTTTCCATTTAACACATCGGG - Intergenic
1098467462 12:70804252-70804274 CTTTACCATTTGAAGACCTCTGG + Intronic
1098669179 12:73203136-73203158 TTCTCCCTACTTAAGACCTCAGG + Intergenic
1099703246 12:86116516-86116538 GTTTTCCAATTTAAGAACTGAGG - Intronic
1100688926 12:97018040-97018062 CATTTCAAATCTAAGACCTCTGG + Intergenic
1105650855 13:22375474-22375496 CACTTTCACTTAAAGACCTCTGG - Intergenic
1106090765 13:26591271-26591293 CTCTTCCATTTCAAACCCTCTGG - Intronic
1106535071 13:30633138-30633160 CTCATCTACTTTCAGACCTCGGG - Intronic
1107386579 13:39916282-39916304 TTCTTTGAATTTAAGACCACGGG - Intergenic
1109181351 13:59217680-59217702 CTCTTTTCATCTAAGACCTCAGG - Intergenic
1110431514 13:75429380-75429402 CTGTTCCATATTAAGACTTCGGG - Intronic
1112691618 13:101902351-101902373 CTCTTTCATTTAAATACCTCTGG - Intronic
1115345929 14:32343397-32343419 CTGTTCCAATTCCAGACCTGTGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118194830 14:63615327-63615349 CTGTTCCAAATTAAGACATCTGG - Intronic
1119838915 14:77776023-77776045 CTTTTACAAGATAAGACCTCAGG - Intergenic
1124547637 15:30646442-30646464 CTCATCTACTTTAAGACCTAAGG - Intronic
1125203948 15:37129758-37129780 ATATTCCAAATTAAGTCCTCAGG - Intergenic
1127637877 15:60888711-60888733 CTCTTTCCCTTTAAGACATCAGG + Intronic
1128303667 15:66583433-66583455 CTCTTAAAATTTAAGTCCTTTGG + Intronic
1129858811 15:78844268-78844290 CTCTTCCAACTTAGCTCCTCTGG + Intronic
1131215432 15:90531193-90531215 GTCTTCCAATTTAAAAATTCTGG - Intronic
1131600011 15:93837646-93837668 CTCTTCCAATTTAAGACCTCAGG - Intergenic
1134544896 16:15100662-15100684 CTCTTCCAATTAAGAACCACTGG + Intronic
1134875046 16:17690676-17690698 CTCTTCTGATCTGAGACCTCTGG + Intergenic
1135362527 16:21827379-21827401 CTCTTCCAATTAAGAACCACTGG + Intergenic
1137353627 16:47736338-47736360 CTCCACCACTTTAAGACTTCGGG - Intergenic
1144262046 17:13531251-13531273 CTCTTCAAAATCAAGAACTCGGG + Intronic
1145256443 17:21326006-21326028 CTATTCAAATTTAGGACCGCAGG + Intergenic
1145320169 17:21761946-21761968 CTATTCAAATTTAGGACCGCAGG - Intergenic
1145401911 17:22546660-22546682 CTCTTCCACTTTACGTCATCAGG - Intergenic
1147796139 17:43044605-43044627 CTCTTAAAATATAAGACCTCTGG - Intronic
1150931568 17:69590497-69590519 CTGTTCCCATTTAGGGCCTCAGG + Intergenic
1155498719 18:26466309-26466331 CTCCTGCAATTTAAGTCTTCAGG + Intronic
1155822067 18:30390812-30390834 CTGTCCCAATTTAGGACCACAGG - Intergenic
1156007298 18:32457717-32457739 CTCTGCCAATTTAGCACCTGAGG - Intronic
1156054465 18:32982206-32982228 CTTTTGCAATTTAAGAACCCTGG + Intronic
1158445520 18:57517245-57517267 ATGTTTCAATTTAAGAACTCTGG - Intergenic
1158547580 18:58409331-58409353 CTGTTCCTCCTTAAGACCTCTGG - Intergenic
1158580008 18:58672205-58672227 CTTTTGCATTTTAAGTCCTCTGG - Intronic
1159162534 18:64661497-64661519 CTCTTCCCATTGAAAACCACTGG - Intergenic
1159166672 18:64711049-64711071 CTCTTTCAATTTTTGACCTTTGG + Intergenic
1161925285 19:7294609-7294631 CTCCTCCAGTTTCAGACCCCCGG + Intergenic
1164375458 19:27679923-27679945 CTCTACCATTTTAAGGCCTGGGG + Intergenic
1167740944 19:51324664-51324686 CTCTTCTAATTGACGACGTCTGG - Intronic
926959231 2:18335917-18335939 CTCTTCTAATTGAAGACCTTGGG + Intronic
927556591 2:24038645-24038667 TTCTTCCTATTTAGAACCTCTGG - Exonic
928518754 2:32067458-32067480 TTCTTCAAATCTAAGAGCTCAGG - Intronic
929702947 2:44180534-44180556 CTCTGCCAATTTAATATTTCTGG + Intronic
931328420 2:61253061-61253083 CTGTTCTATTTTCAGACCTCTGG - Intronic
936046585 2:109193153-109193175 CTCTTAAAATGTGAGACCTCTGG - Intronic
936476357 2:112843373-112843395 CTCTCCCACTTTGAGGCCTCTGG - Intergenic
939908998 2:147956548-147956570 CTCTGCCATTTTATGACCTTCGG + Intronic
943142098 2:183995731-183995753 CTCTGCCAATCTCAGAACTCAGG - Intergenic
944902972 2:204234745-204234767 CACTTCCAATATAACTCCTCCGG + Intergenic
945028407 2:205641539-205641561 CTCTTCCGATTGAAGAGGTCTGG + Intergenic
945785525 2:214230972-214230994 TGCTTCCAATTTAAGATCTTTGG - Intronic
946805484 2:223467026-223467048 CTATTCCTATTGAGGACCTCAGG + Intergenic
1169696964 20:8400357-8400379 CTCTTGCCATTTATGACCTTTGG + Intronic
1171568419 20:26219785-26219807 CTCTTCCTATTTGAGCCTTCTGG - Intergenic
1172607689 20:36225650-36225672 CCCTTCCAATTACAGTCCTCTGG + Intronic
1172664796 20:36591552-36591574 ATCTTCCTGTTGAAGACCTCTGG - Exonic
1177630076 21:23715038-23715060 CTCTCCCAATTTAGGGCCACAGG + Intergenic
1178086800 21:29120380-29120402 CTCTTACACTTTATGAGCTCTGG + Intronic
1178178303 21:30129981-30130003 CTGTTCTCATTTAGGACCTCGGG + Intergenic
1179519857 21:41935478-41935500 CTCTGGCAAGTTCAGACCTCAGG - Intronic
1181416161 22:22760431-22760453 CTTATCCAATGAAAGACCTCAGG - Intronic
1183493937 22:38131654-38131676 CTCTTCCAAGTTTTGACCTTTGG + Intronic
949431931 3:3986277-3986299 TTCTTCCAAGTTAAAACATCAGG + Intronic
949649464 3:6139105-6139127 CTCCTACAATATAAGGCCTCAGG + Intergenic
949729602 3:7093168-7093190 CTCTTCCACTTGGAGACTTCAGG + Intronic
949913249 3:8933298-8933320 CTCTTTTACTCTAAGACCTCAGG - Intronic
954515125 3:51167565-51167587 TTCTTCCAATTTATGAACACTGG + Intronic
957875228 3:86136838-86136860 CTATCCCAATTTCAGGCCTCTGG - Intergenic
961343165 3:126243926-126243948 CTGTTCCCATTTAGGGCCTCGGG + Intergenic
961343950 3:126248868-126248890 CTGTTCCAATTTAGGGCCTCGGG + Intergenic
964343563 3:155733090-155733112 TTCTTCCAATTTATGAACACAGG - Intronic
966023373 3:175243812-175243834 ATCTTCCCATTTCAGACCTTGGG - Intronic
966866086 3:184259911-184259933 CTCATGCACTTTAAAACCTCGGG - Exonic
967540225 3:190658405-190658427 CTCCTCAAATTGAAGACATCTGG + Intergenic
971383325 4:26119824-26119846 CTCAGCCATTTTAAGGCCTCAGG - Intergenic
973143617 4:46797980-46798002 CCCTTTGAATTTAAGACCTGGGG - Intronic
973231118 4:47839545-47839567 CTCTTCCACTTTCTGCCCTCTGG + Intergenic
973571391 4:52243237-52243259 CTCTACCAACATAAGACCTTAGG - Intergenic
974087337 4:57275457-57275479 ATCTTCCAACTTCAGCCCTCTGG - Intergenic
975394966 4:73864088-73864110 CTCTTCCAATGTAATGACTCTGG - Intergenic
975410509 4:74043322-74043344 CTCTTCCAATGTAATGACTCTGG + Intergenic
980419132 4:132537390-132537412 CTCTTTCAATTGAAGACTTTTGG + Intergenic
983049038 4:163022385-163022407 CTCATTTAATTTAAGAACTCTGG - Intergenic
983373142 4:166890029-166890051 TTATTCCAATGTAAGACCTATGG - Intronic
985541520 5:489682-489704 CTCTTCCAAACTCAGGCCTCAGG + Intronic
987228395 5:15867702-15867724 CTCTTCCACTTTAAGCACCCAGG - Intronic
989076709 5:37571557-37571579 CTCTTCCAATGTAAACCCTTGGG - Intronic
989413554 5:41147912-41147934 CTCTGCCAATTTAATACTTAAGG - Intronic
990495449 5:56343205-56343227 CTCTACCCAATTAAGTCCTCTGG + Intergenic
992741049 5:79774073-79774095 CGATTCCAATTTAAGACCAAAGG + Intronic
994726768 5:103445464-103445486 CTCTCCAAATATAAGATCTCAGG - Intergenic
995100866 5:108303443-108303465 GTCTTCCAATTTAAGACTACAGG + Intronic
996671584 5:126123673-126123695 CTCTTCCCATTTAGGGCCACGGG + Intergenic
996778748 5:127160566-127160588 CTCTTCCAGCCTAAGAGCTCTGG - Intergenic
997424961 5:133796799-133796821 CTGTTCCCATTTAGGGCCTCGGG + Intergenic
998762660 5:145449594-145449616 CTGTTCCCATTTAGGACCACAGG + Intergenic
1000739916 5:164955758-164955780 CTCTTTAAATTTAAAAACTCAGG + Intergenic
1000882424 5:166713694-166713716 TTCTTTCAATGTAAGACCTAGGG + Intergenic
1006268460 6:32945088-32945110 CTCTTCTCTTTTAAGACCACTGG - Intronic
1007525448 6:42488705-42488727 CTTTTCAAATTTAAGAGCGCAGG - Intergenic
1007711474 6:43826847-43826869 TTCTTGCAAGATAAGACCTCAGG + Intergenic
1010946323 6:81977214-81977236 CTCCTCCAATTTAACACTGCAGG + Intergenic
1013160585 6:107540260-107540282 CTCCTCCATTTCAATACCTCTGG + Intronic
1013612769 6:111810585-111810607 TCCTTTCAAGTTAAGACCTCAGG + Intronic
1015805003 6:137100017-137100039 GTGTTGCAAGTTAAGACCTCAGG + Intergenic
1016902097 6:149113226-149113248 CTATTCCCATTTAAGGCCTTGGG - Intergenic
1017748150 6:157465728-157465750 CTCTACCAAGTTCAGACCTCTGG - Intronic
1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG + Intergenic
1022901116 7:34811521-34811543 CTGTTCTCATTTAAGACCACTGG + Intronic
1032003972 7:128285401-128285423 CTCTTCTAACTTAAAACTTCAGG - Intergenic
1033350781 7:140559990-140560012 CACTTCCAACTATAGACCTCTGG + Intronic
1036498454 8:9292064-9292086 ATCTTCCAAATTTAGTCCTCTGG - Intergenic
1037339587 8:17830139-17830161 CTCTTCCTAATTAACACCCCTGG - Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1042693791 8:71533179-71533201 CTCTTCCAATTTATGACACAAGG + Intronic
1043240743 8:77931795-77931817 TTCCTCCTATTTTAGACCTCAGG - Intergenic
1044331817 8:90929421-90929443 CTTTTCCAAATTCAGACCTCTGG - Intronic
1044427257 8:92066319-92066341 CACTTTCAATTTCAGACCACTGG + Intronic
1045965388 8:108018641-108018663 CTGTTCCTATTTAAGACATTTGG - Intronic
1047037550 8:120956024-120956046 CACATCCAATTAAAGACCTGTGG - Intergenic
1047408044 8:124601598-124601620 CCCTGCCAATTTAGGACTTCTGG - Intronic
1060918701 9:127405849-127405871 CTCTTCCCATGTAAGACCTTAGG - Intronic
1186032021 X:5378685-5378707 CTATTCCTATTTAGGGCCTCAGG - Intergenic
1187928013 X:24268034-24268056 CTCTTCAATTGTATGACCTCAGG + Intergenic
1188190442 X:27165777-27165799 CTCATCCATTTTAAGAACACAGG + Intergenic
1189133447 X:38524477-38524499 CGCTGCCAGTTTAAAACCTCTGG + Intronic
1189628575 X:42926396-42926418 TTCTTCCAATCTAAGAACACGGG - Intergenic
1194281991 X:91964182-91964204 TTCTTTCAATTTAAGAACACAGG - Intronic
1196017482 X:110955374-110955396 CCCTTCCAATTGGAGCCCTCAGG + Intronic
1197795125 X:130290166-130290188 CCCTTTCATTTTAAGACCTAGGG - Intergenic
1200599588 Y:5188842-5188864 TTCTTTCAATTTAAGAACACAGG - Intronic
1201944054 Y:19492245-19492267 GTCTTCCAATTTATGAACACAGG - Intergenic
1202388653 Y:24348157-24348179 CTCTTTCGCTTTATGACCTCAGG + Intergenic
1202482134 Y:25321971-25321993 CTCTTTCGCTTTATGACCTCAGG - Intergenic