ID: 1131605651

View in Genome Browser
Species Human (GRCh38)
Location 15:93900456-93900478
Sequence GCTCTCAGTAGACCTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 39, 3: 73, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131605651 Original CRISPR GCTCTCAGTAGACCTGAAGC AGG Intergenic
900588462 1:3445580-3445602 GCTCACAGCAGACCTGACGCTGG - Intergenic
901738533 1:11327551-11327573 CCTCTCGGAAGACCTGAAGCGGG + Intergenic
903442383 1:23397795-23397817 GCTGTCAGCAGCCCTGAAGGCGG - Exonic
904551827 1:31325215-31325237 GCTCTCAGGAGACCCAAAGTAGG - Intronic
904732660 1:32606628-32606650 GCTCTCAGGAGACCTGAAGTGGG + Intronic
905215143 1:36401458-36401480 GCTCTCGGGAGACCTGAAGTGGG + Intergenic
906730121 1:48073835-48073857 CCTCTCAGCAGACCTGAGGGAGG + Intergenic
907985383 1:59524742-59524764 GCTCTCAGAAGACCCAAAGTGGG - Intronic
909197826 1:72649185-72649207 GCTCTCAGGAGACCTAAAGCTGG - Intergenic
909599690 1:77448527-77448549 ACTCTCAGGAGACCTGAAGTGGG - Intronic
911025729 1:93434200-93434222 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
911520800 1:98927596-98927618 TCTCTTAGTACACCTGCAGCAGG - Intronic
911935136 1:103960509-103960531 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912013689 1:105005212-105005234 GCTGTCAGGAGACCTGTAGTGGG + Intergenic
912062115 1:105686645-105686667 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912065592 1:105736983-105737005 GCTCCCAGTAGTCTTAAAGCAGG - Intergenic
912094506 1:106121492-106121514 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
913202299 1:116504691-116504713 GATGTCAGTAGAGCTGAAGCTGG - Intergenic
916963776 1:169914656-169914678 GCTCTCAGAAGACAAAAAGCGGG - Intergenic
918016178 1:180634614-180634636 GCTATCAGTAGAACAGATGCTGG + Intronic
918238565 1:182602336-182602358 GCTCTCAGCAGTCCTGGGGCTGG + Intronic
919264045 1:195238075-195238097 ACTCTCAGGAGACCCGAAGTGGG - Intergenic
919302798 1:195791404-195791426 GTTCTCAGGAGACCCGAAGTAGG - Intergenic
920555975 1:206904919-206904941 GCTCTGAGAACACATGAAGCAGG + Exonic
921674649 1:217964790-217964812 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
921766891 1:218983105-218983127 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
922141640 1:222893957-222893979 GTTCTCAGGAGACCCGAAGTGGG + Intronic
923786140 1:237071136-237071158 ACTCTCATGAGACCTGAAGTGGG + Intronic
1066188913 10:33037436-33037458 GCTCTCAGGAGACCTACAGTGGG - Intergenic
1066814893 10:39394328-39394350 GTTCTCCATAGGCCTGAAGCTGG - Intergenic
1067229070 10:44394431-44394453 GCTCTCAGTCCTCCTGAAGAGGG + Intergenic
1067258667 10:44667038-44667060 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1068130531 10:52889988-52890010 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1068137466 10:52965080-52965102 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1068213429 10:53952328-53952350 TCTCTCAGGAGACCTGAAATAGG + Intronic
1068290972 10:55001197-55001219 GCTCTCAGGAGACCCGAAGTGGG - Intronic
1068474472 10:57507481-57507503 GCTCTTAGGAGACCCGAAGTGGG - Intergenic
1068919281 10:62465653-62465675 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1069561738 10:69435601-69435623 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
1070201141 10:74207507-74207529 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071166751 10:82816335-82816357 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071819318 10:89264322-89264344 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1073845123 10:107545441-107545463 GCTCTCAGGATACCTGAAGTGGG - Intergenic
1075132049 10:119748561-119748583 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1075165327 10:120063060-120063082 GCACACTGTAGACCTGAAGGAGG + Intergenic
1075778973 10:125004937-125004959 GCTCTTAGTAGTCCCCAAGCTGG + Intronic
1077844661 11:6012243-6012265 GCTCAGAGAAGACCTGAAGTGGG + Intergenic
1078415062 11:11158012-11158034 GCTGCCATGAGACCTGAAGCTGG - Intergenic
1079099404 11:17531502-17531524 GCTCGTGGGAGACCTGAAGCTGG - Exonic
1079225627 11:18602337-18602359 GCTCTTAGTATACCTGGGGCTGG - Intergenic
1079503911 11:21132957-21132979 GCTCTCAGGAGACCCGAAGTAGG + Intronic
1079997034 11:27305507-27305529 GCTCTCAGGAGACTGGAAGTGGG - Intergenic
1081767322 11:45620758-45620780 GCTCTCAGGAGACCAAAAGTGGG + Intergenic
1082687665 11:56260135-56260157 GCTCTAAGGAGACCTGCAGTGGG + Intergenic
1082788427 11:57330529-57330551 GCTCCCAGAAGACCTGGGGCTGG + Intronic
1083661951 11:64255553-64255575 GTTCTCAGCAGACAAGAAGCGGG + Exonic
1083916136 11:65744791-65744813 GCTCTCAGGAGACCCGAAATGGG - Intergenic
1085334182 11:75678597-75678619 GCTCTCAGGAGACCTGCAGTGGG + Intergenic
1085403979 11:76250835-76250857 GCTCTCAGGAGACCTGAAGTAGG - Intergenic
1087407842 11:97752102-97752124 GCTTTCAGGAGACCTGAAGTGGG + Intergenic
1087453381 11:98353107-98353129 GCTTTTAGGAGACCTGAAGTGGG + Intergenic
1087500017 11:98938988-98939010 GCCCTCACAAGACCAGAAGCTGG - Intergenic
1088287922 11:108206839-108206861 GCCCTCAGGAGACCTGCAGTGGG + Intronic
1089849487 11:121483947-121483969 GCTGTCAGGAGCCCTCAAGCAGG + Intronic
1089880038 11:121764954-121764976 GCACTCAGGAGACCTGAAAGAGG - Intergenic
1090041968 11:123299430-123299452 GCTCTCAGAAGACCTGAAGTGGG - Intergenic
1090631307 11:128651460-128651482 GTGCTCAGTAGACATGAAACTGG - Intergenic
1091173644 11:133540794-133540816 GCACTTAGTAGCCATGAAGCAGG + Intergenic
1092271995 12:7030883-7030905 GCTCTCAGGAGACCTGTAGTGGG + Intronic
1093317179 12:17666433-17666455 GCTCTCAGGAGACTGGAAGTGGG + Intergenic
1093502392 12:19827803-19827825 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
1094845296 12:34358874-34358896 GCGCTCAGTGGGCATGAAGCAGG + Intergenic
1094848778 12:34373100-34373122 GCACTCTGTAGACATGAACCAGG + Intergenic
1094872722 12:34607100-34607122 GCTCTCTGTGGACATGAACCAGG - Intergenic
1096355483 12:50937717-50937739 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1097360756 12:58655941-58655963 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1097684271 12:62677165-62677187 GTGCTCAGGAGACCTGAAGTGGG - Intronic
1098790611 12:74817224-74817246 GTTCTTAGGAGACCTGAAGTGGG - Intergenic
1099049724 12:77768002-77768024 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1100672764 12:96834909-96834931 GCTCACAGGAGACCTGCAGCAGG + Intronic
1101759079 12:107644500-107644522 GCTCTCAGAATACCTGGAGAAGG + Intronic
1102728861 12:115090348-115090370 GCACTCAGTAGGACTGAGGCAGG + Intergenic
1103173721 12:118843987-118844009 GCTCTCAGGAGACTTTAAGTGGG - Intergenic
1106253472 13:28001615-28001637 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1107841206 13:44459422-44459444 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1109348517 13:61145846-61145868 GCTCTCAGGAGACCCGAAATGGG - Intergenic
1109686695 13:65830124-65830146 GCTCTCAGGAGACCCGCAGTGGG - Intergenic
1109687835 13:65844165-65844187 GTTCTCAGGAGACCTGCAGTGGG - Intergenic
1109780816 13:67107599-67107621 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1110439097 13:75507753-75507775 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1111119281 13:83824288-83824310 GCTCTCAGGAGAGCTGAAGTGGG - Intergenic
1111202785 13:84961722-84961744 GCTCTCAGGAGACCCGTAGTGGG + Intergenic
1111243775 13:85508604-85508626 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1111268875 13:85854058-85854080 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1111595433 13:90404474-90404496 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1112086173 13:96034357-96034379 GCTCTTAGGAGAACTGAAGTTGG - Intronic
1112292021 13:98152469-98152491 GTTTTTACTAGACCTGAAGCAGG + Intronic
1113503124 13:110793854-110793876 GCTCTTAGGAGACCTGGAGTGGG - Intergenic
1114055205 14:18962662-18962684 GTTTTCAGGAAACCTGAAGCCGG + Intergenic
1114107338 14:19439116-19439138 GTTTTCAGGAAACCTGAAGCCGG - Intergenic
1114344556 14:21781362-21781384 GCGCTCAGGAGACCTGAAATGGG - Intergenic
1114674189 14:24430080-24430102 GCGCTGAGAGGACCTGAAGCCGG + Intronic
1115310542 14:31974432-31974454 GCCCTCAGGAGACCCGAAGTGGG + Intergenic
1116159715 14:41253370-41253392 GCTCTCAGGAGACCGGAAGTGGG + Intergenic
1116448474 14:45038902-45038924 CCTCTCAGAAGACCTGAAGTGGG + Intronic
1116617312 14:47155158-47155180 GGTCTCAGGAGACCTGAAGTGGG - Intronic
1116789952 14:49329669-49329691 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1116961696 14:50973723-50973745 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1117235569 14:53770851-53770873 TCTCTCAGTAGCCCTTAAGAGGG - Intergenic
1118425126 14:65652224-65652246 GCCTTCAGTGGACCAGAAGCTGG + Intronic
1120592352 14:86390853-86390875 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1122386039 14:101348967-101348989 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1128305232 15:66593960-66593982 GCTCTCAGTAGACAGGCACCAGG - Intronic
1129169774 15:73800536-73800558 CCTATCAGTAGACCCAAAGCTGG + Intergenic
1130877611 15:88028190-88028212 GCTCTCAGTGGTCCTGCAGCAGG + Intronic
1131605651 15:93900456-93900478 GCTCTCAGTAGACCTGAAGCAGG + Intergenic
1131999196 15:98162682-98162704 GCTCTCAGGAGACCTGGAGTGGG + Intergenic
1133078660 16:3300541-3300563 GTTCTAAGTAGAATTGAAGCTGG - Exonic
1135986836 16:27190115-27190137 GCTCTCAGGAGACCAGAAGTGGG - Intergenic
1138412557 16:56851604-56851626 GCTCTCAAGAAACCTGAGGCCGG - Intergenic
1138824920 16:60307584-60307606 GCTCTCAGTACACATAAACCTGG - Intergenic
1138925065 16:61581115-61581137 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1138998261 16:62478394-62478416 GCTCTCAGGAGACCTGAAGTTGG - Intergenic
1144374746 17:14627892-14627914 GGTCTCAGTAGGCTTGAAGTGGG + Intergenic
1146591496 17:34131600-34131622 GCTGTCAGCAGACCACAAGCTGG - Intronic
1148241839 17:46004291-46004313 GCTCTCACTAGACCTTGATCTGG - Intronic
1149169490 17:53792433-53792455 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1149256833 17:54836663-54836685 GTTCTCAGGAGACCTGGAGTGGG + Intergenic
1150868647 17:68880299-68880321 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1153427942 18:4987315-4987337 GCTCTCAGGAAACCTGGAGTGGG + Intergenic
1153473177 18:5468989-5469011 GCTTTCAGGAGACCTGAAGTGGG - Intronic
1159774244 18:72585389-72585411 GCTCTCAGAAGATTTGAAGTGGG + Intronic
1160037953 18:75318878-75318900 GTTCACAGTGCACCTGAAGCAGG - Intergenic
1160083537 18:75753552-75753574 GGTCTCAGGAGACCTAAAGTGGG + Intergenic
1161324487 19:3656865-3656887 GCTCCCAGCACCCCTGAAGCTGG + Intronic
1164607848 19:29612919-29612941 GCTGCCAGAAGACTTGAAGCAGG - Intronic
1165004200 19:32791047-32791069 GCTGTCAGCAGACCTGAAGAAGG + Intronic
1165381504 19:35484765-35484787 GCACTTAGTAGATCTGAAGTGGG + Intergenic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1166871357 19:45872866-45872888 GCTCCCAGGGGAGCTGAAGCTGG + Exonic
1166938751 19:46350464-46350486 GCTCTCAGGAGTCCTGGGGCTGG + Intronic
1166965655 19:46528239-46528261 GCTCTCAGGAGTCCTGGGGCTGG - Intronic
925461506 2:4067267-4067289 GCTCTCAGGCGGCCTGAGGCAGG + Intergenic
928823464 2:35391406-35391428 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
929847082 2:45541552-45541574 GCTCTCAGAAGACCCAAAGCGGG + Intronic
930313585 2:49771596-49771618 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
930914670 2:56672358-56672380 GTTATCAGGAGACCTGAAGCTGG - Intergenic
931232511 2:60386835-60386857 GCTCTCAGAAGATCTGAGGTAGG - Intergenic
932398217 2:71462654-71462676 GCTCTCAGGAAACCCGAAGTGGG + Intronic
932756654 2:74414469-74414491 GCTGCCAGAAGCCCTGAAGCTGG - Exonic
933042632 2:77487885-77487907 GGTCTCAGGAGACCCGAAGTGGG - Intronic
933420888 2:82043698-82043720 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
933606485 2:84389621-84389643 GCTCTCAGGAGACCCAAAGTTGG + Intergenic
934129776 2:88936875-88936897 GCACTCATTAGCCCTTAAGCAGG + Intergenic
936086747 2:109474512-109474534 GCCCTCAGTTGGCCTGAGGCTGG + Intronic
936902659 2:117501168-117501190 GCTCTAAGTAATACTGAAGCAGG + Intergenic
937219903 2:120336773-120336795 GCTCCCTGTGGACCTGAATCAGG + Intergenic
937370802 2:121296044-121296066 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
938697891 2:133851135-133851157 GCTCACAGATGACCAGAAGCAGG + Intergenic
939466425 2:142562374-142562396 GCTCTCTGAAGACATGAAGTGGG - Intergenic
939925898 2:148172958-148172980 GCTCTCAGGAGATCTGAAGTGGG - Intronic
940398638 2:153222166-153222188 GCTCTCAGGAGGCCTGAAGTGGG + Intergenic
940956916 2:159738526-159738548 GCTCTCAGGAGACCCAAAGTGGG + Intronic
941432366 2:165427446-165427468 GCTCTCAGGAGACCTGAAATGGG - Intergenic
943064147 2:183069466-183069488 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
943932212 2:193868482-193868504 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
943960268 2:194254775-194254797 GCTCTCAGAAGACCCAAAGTGGG - Intergenic
944170382 2:196769792-196769814 GCTCTCAGTACACATGACGGGGG - Intronic
945721370 2:213421936-213421958 GCTCTCAGGAGACCCAAAGTGGG - Intronic
945884542 2:215361404-215361426 GCTGTGAGTTGAGCTGAAGCTGG + Exonic
946194200 2:218023372-218023394 GCTCACAGCAGCCCTGAAGGGGG - Intergenic
946384475 2:219374220-219374242 GTTCTCAGCTGAGCTGAAGCTGG - Exonic
947054772 2:226087751-226087773 GCTCTCAGGAGCCCTGAAGTGGG + Intergenic
948334890 2:237200212-237200234 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1170327893 20:15176597-15176619 GCCCTCAGGAGACCCGAAGTGGG - Intronic
1173943957 20:46935137-46935159 GCCCTGAGTAGAGCTGATGCAGG - Intronic
1174120678 20:48262955-48262977 GCTCTAAGTTCCCCTGAAGCAGG - Intergenic
1174343892 20:49915476-49915498 GGTCTCAGTACCCCTGCAGCCGG - Intronic
1175138610 20:56843114-56843136 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1175232144 20:57480813-57480835 GCTCTCACTAAACCGGAGGCTGG - Intergenic
1175896957 20:62341392-62341414 ACTGTCAGTAGTCCTGAGGCTGG - Intronic
1176678825 21:9806469-9806491 GCGCTCAGTGCTCCTGAAGCTGG - Intergenic
1177344610 21:19853720-19853742 GCTCTCAGGGGACCCGAAGTGGG + Intergenic
1177459950 21:21397067-21397089 GCTCTCAGTAGACCCTAAGTGGG + Intronic
1177624825 21:23646324-23646346 TCTCTCAGGAGACCTGAAGTGGG + Intergenic
1177710873 21:24772701-24772723 GGTCTCACTAGACTTGAAGTGGG - Intergenic
1178937464 21:36875638-36875660 GCTCTCAGGAGACTTGAAGTGGG - Intronic
1178947416 21:36959729-36959751 GCTCTCAGGAGACCTGAAGTGGG - Intronic
1180473687 22:15685212-15685234 GTTTTCAGGAAACCTGAAGCCGG + Intergenic
1181085317 22:20437018-20437040 GCTCGAAGTGGACCAGAAGCGGG - Intronic
1181137238 22:20776883-20776905 GAACTCAGTAGGCCTGAAGATGG - Intronic
1181402173 22:22656604-22656626 GCTCTCACTAGACATGCAGGCGG - Intergenic
1181843824 22:25689798-25689820 GTTCTCAGAAGCCCAGAAGCTGG + Intronic
1182369501 22:29801007-29801029 GGACTCAGTAGACCTGAGCCGGG - Exonic
1185046342 22:48530497-48530519 TCTCTCTGTAAACCTGCAGCAGG - Intronic
949226414 3:1700369-1700391 GCTCTCAGGAGACCTGCAGTGGG - Intergenic
950289339 3:11770984-11771006 GCTCTCCGCAGCCCTGAGGCGGG + Intergenic
953926772 3:46986558-46986580 GTGCTCAGTAGAGCTGCAGCTGG + Intronic
955111848 3:55958121-55958143 GCTCTCAGGAGACCCGAAATGGG + Intronic
957156531 3:76551360-76551382 GCTCTCAGGAGACCTGAAGTGGG - Intronic
957459359 3:80497146-80497168 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
957665282 3:83218285-83218307 GCTATCAGGAGACCTGCAGTGGG + Intergenic
959252575 3:103966458-103966480 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959863617 3:111242561-111242583 GCTCACAGGAGACCTGCAGGAGG + Intronic
959897139 3:111617635-111617657 GCTCTCAGGAGACCTGAAGTGGG - Intronic
961143375 3:124574258-124574280 TCTCCAAGTAGAACTGAAGCAGG + Intronic
961311435 3:126004382-126004404 GCTCTCAGGAGACCCGGAGTGGG - Intergenic
964075137 3:152684197-152684219 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
967005853 3:185381579-185381601 GCACTAAGTAGACCTCAAGAAGG - Intronic
967899744 3:194437310-194437332 GGTCTCTGTAAACCTGAAACAGG - Exonic
968142908 3:196273495-196273517 GCCCTCAGGAGACCCCAAGCGGG + Intronic
969179275 4:5424622-5424644 GCTCTCAGGAGACCTGAAGTGGG - Intronic
969239926 4:5891245-5891267 GCTCTCCGTGGTCCTGAAGCCGG - Intronic
970082551 4:12304067-12304089 GCCCTCAGTAGGACTGAAGAAGG + Intergenic
970526609 4:16938885-16938907 ACTGTCAGTTGAACTGAAGCAGG + Intergenic
971092463 4:23361153-23361175 GCTCTCAGGAGACCTGCAGTGGG - Intergenic
971834600 4:31747726-31747748 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
973026860 4:45283985-45284007 GTTCTCAGGGGACCTGAAGTGGG + Intergenic
974023484 4:56711813-56711835 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
974432619 4:61817552-61817574 GCTCTCAGGAGACCTGAAGTGGG - Intronic
975023598 4:69521092-69521114 GCTCTCAGGAGACCCTAAGTGGG - Intronic
975299772 4:72775626-72775648 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
976921412 4:90448990-90449012 CCTCTCAGGAGACCTGAAGTTGG + Intronic
976922628 4:90457507-90457529 GCTCTCCAGAGACCTGAAGTGGG + Intronic
977568831 4:98609608-98609630 GCTCAGAGTAGACCTGCACCTGG - Intronic
979492272 4:121341847-121341869 GCCATGAGAAGACCTGAAGCGGG - Intronic
979637832 4:122977790-122977812 GCTCTCAGGAGACCTGAAGTGGG + Intronic
980582750 4:134774497-134774519 GCTCTCAGGAGAACTGAACTGGG - Intergenic
980740764 4:136947108-136947130 GGTCTCAGAAGATCTGAAGTGGG - Intergenic
981889162 4:149715731-149715753 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
983069673 4:163253893-163253915 GCTCTCAGGAGACCTGGAGTGGG + Intergenic
983323827 4:166227828-166227850 GCTCTCAGAAGACCCAAAGTTGG - Intergenic
983380067 4:166981073-166981095 GCTCTTAGGAGACCTGAAATGGG + Intronic
984763855 4:183384687-183384709 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
985396726 4:189552477-189552499 GCGCTCAGTGCTCCTGAAGCTGG + Intergenic
986327417 5:6686588-6686610 GCTCTCAGCAGTACTGTAGCGGG + Intergenic
987537750 5:19209305-19209327 GCTCTCAGGAGATCTGAAGTGGG - Intergenic
988346398 5:30042464-30042486 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
989537650 5:42582465-42582487 GTTCTCAGGAGACCTGAAGTGGG - Intronic
989730422 5:44641582-44641604 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
990878811 5:60517708-60517730 GCTCCCAGGAGACCTGAAGTGGG - Intronic
991039626 5:62162266-62162288 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
992680634 5:79149543-79149565 GCTCTCAATATAATTGAAGCAGG + Intronic
993184002 5:84592457-84592479 CCTCTCAGCAGACCTGAACCAGG - Intergenic
994692322 5:103034309-103034331 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
995709179 5:115017399-115017421 GTACTCAGGAGGCCTGAAGCAGG + Intergenic
995927058 5:117386754-117386776 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1000894935 5:166844201-166844223 GGTCTTAGTAGATGTGAAGCTGG + Intergenic
1001337833 5:170815160-170815182 GATTACAGTAGACCTCAAGCTGG + Intergenic
1001741213 5:174054406-174054428 TCTCTCTGTCGTCCTGAAGCTGG + Intronic
1002090410 5:176802358-176802380 CCTGTCAGTAGACCTGAAGAGGG + Intergenic
1002677989 5:180934983-180935005 ATTCTCAGGAGACCTGAAGTGGG + Intronic
1004133639 6:12945640-12945662 GCTCTGAGAAGTCCTGCAGCAGG - Intronic
1004720767 6:18265825-18265847 GCTCTCCTGAGACCTGAAGTGGG + Intergenic
1005085148 6:21998746-21998768 GCTCTCAGTTCTCCTGAAGTGGG + Intergenic
1005594768 6:27368525-27368547 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1006463766 6:34178902-34178924 GCTCTCAGGAGACCCGGAGTGGG + Intergenic
1006766205 6:36509235-36509257 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1007914211 6:45545956-45545978 GCTTCAAGTTGACCTGAAGCTGG + Intronic
1008936660 6:56999591-56999613 GCTATCAGGAGACCTGAAGGTGG + Intronic
1009817219 6:68751761-68751783 GTTCTCAATAGACATGAAACAGG - Intronic
1010559690 6:77333858-77333880 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
1011822586 6:91271198-91271220 GCTCTCAGGAGACCTGTAGTGGG + Intergenic
1012100858 6:95084217-95084239 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1012709598 6:102582268-102582290 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1012749490 6:103140037-103140059 GCTCCCAGGAGACCTGAAGTGGG + Intergenic
1013063643 6:106661612-106661634 GCCCTCAGTAAAACTGGAGCAGG + Intronic
1013438539 6:110138542-110138564 GCTCTCAGGACACCGGAAGCGGG + Intronic
1014227118 6:118861540-118861562 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1014384766 6:120786469-120786491 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1014418704 6:121214912-121214934 GCTCTCAGGAGACCAGAAGTGGG + Intronic
1016163258 6:140907848-140907870 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1016210877 6:141531878-141531900 GCTCTTAGGAGACCTGAGGTGGG - Intergenic
1017587977 6:155947588-155947610 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1020832513 7:13109858-13109880 GCTGTCAGATGACCTGAAGTGGG + Intergenic
1021431096 7:20559926-20559948 GCTCTCAGGAGACCTAAAGCGGG + Intergenic
1021677715 7:23097739-23097761 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1022186750 7:27976667-27976689 GCTCTCAGAAGACCATAAACAGG + Intronic
1024378828 7:48670787-48670809 GCTATCATTAGACCCGAGGCTGG + Intergenic
1026222700 7:68414204-68414226 GCACTCAGTAGACCTGGAAAAGG + Intergenic
1026391989 7:69911583-69911605 GCTCCCAGGAGACCTCAAGTGGG + Intronic
1027453171 7:78356303-78356325 GCCCTCAGAAGAACTGAACCTGG - Intronic
1027463855 7:78489964-78489986 GTTCTAAGTAGCCCTGAAGGAGG + Intronic
1027924878 7:84447628-84447650 GCTCTTAGGAGACCCGAAGTGGG - Intronic
1027995832 7:85424214-85424236 GCTCTCAGGAGGCCTGAAGTGGG - Intergenic
1028035086 7:85972200-85972222 GCTCTGAGAAGACCTGAAGTGGG + Intergenic
1028053039 7:86208379-86208401 GCTCTCAGGAAACCTGGAGCGGG + Intergenic
1028136809 7:87230926-87230948 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1030981065 7:116186014-116186036 GCTCTCAGGGGACCTGAAATAGG + Intergenic
1031921921 7:127608696-127608718 GCTCTCAGAAGACCGGAAGTAGG + Intergenic
1034101759 7:148456980-148457002 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1034163209 7:149007314-149007336 GCTCTCATGGGACCTGGAGCAGG - Intronic
1036591301 8:10171046-10171068 GCTCTCAAAAGACCTACAGCTGG - Intronic
1036907684 8:12720770-12720792 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1038585725 8:28787388-28787410 GCAGTCAGTAGAACAGAAGCAGG + Intronic
1041138125 8:54782846-54782868 GCTCTCAGTATCACTGCAGCAGG + Intergenic
1042625159 8:70749116-70749138 ACTCTCAGGAGACCTGAAGTGGG - Intronic
1042665348 8:71198346-71198368 GCCCTCAGAAGAACTGATGCAGG + Exonic
1043180538 8:77082605-77082627 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1043798600 8:84578562-84578584 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1045300684 8:100907902-100907924 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1045888066 8:107123230-107123252 GCTCTCAGGAGACCTGGAGTGGG - Intergenic
1046195772 8:110860978-110861000 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1046775419 8:118158891-118158913 GCTCTCTGGAGACCTGAAGTGGG - Intergenic
1047543904 8:125797266-125797288 GCTCTCAGGAGACCTGAAGTAGG + Intergenic
1048339074 8:133525159-133525181 GCTTTCAGGAGACCTGCAGTGGG + Intronic
1048518575 8:135133268-135133290 GCTCTGAGAAGTCCTGCAGCAGG + Intergenic
1048547897 8:135404370-135404392 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1049140530 8:140950066-140950088 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1049335224 8:142080731-142080753 GCTCTGAGAAGTCCTGCAGCCGG + Intergenic
1050461196 9:5879081-5879103 ACTCACAGTAGAGCTGATGCTGG + Intergenic
1052580587 9:30349589-30349611 GCTCTGAGGAGACCTGAAGTGGG + Intergenic
1052623558 9:30944617-30944639 GCTCTCAGGAGACACGAAGTTGG - Intergenic
1052691496 9:31821314-31821336 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
1052993551 9:34537008-34537030 GCTCTCACCATCCCTGAAGCTGG + Intergenic
1055816571 9:80213366-80213388 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1056994402 9:91443037-91443059 GCTCTCAAGAGACCTAAAGTGGG + Intergenic
1058545724 9:106059086-106059108 GTTTTCAGGAGACCTGAAGTGGG + Intergenic
1059104853 9:111502160-111502182 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1059681574 9:116590934-116590956 GCCCTCAGGAGACTTGAAGTGGG - Intronic
1061743196 9:132722287-132722309 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1203663996 Un_KI270754v1:9005-9027 GCGCTCAGTGCTCCTGAAGCTGG - Intergenic
1186033049 X:5391038-5391060 GCTTTCAGCGGACCAGAAGCAGG + Intergenic
1188194974 X:27222373-27222395 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1188434940 X:30148909-30148931 GTTCTCAGGAGACCAGAAGTGGG - Intergenic
1189207773 X:39256733-39256755 GCCCAAAGTAGACCTGAAGAGGG + Intergenic
1192267248 X:69547235-69547257 GCTCTCGGGAGACCTGAAGTGGG - Intergenic
1193451947 X:81681977-81681999 GCTGTGAGTTGAGCTGAAGCTGG - Intergenic
1197035718 X:121870833-121870855 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1198189523 X:134288332-134288354 GCTCTCAGGAGACTTAAAGTGGG - Intergenic
1199564961 X:149206069-149206091 GCAGTCAGAAGACATGAAGCTGG - Intergenic
1200411668 Y:2867790-2867812 GCTCTCTGTAAAGCTGCAGCTGG + Intronic
1200424827 Y:3009221-3009243 GCTCTCAGGAGACCTGCAGTGGG + Intergenic
1200749123 Y:6928932-6928954 GCTCTCAGGAGACCTAAAGTGGG + Intronic
1200871083 Y:8099141-8099163 TCTCTCAGTAGACCAATAGCAGG - Intergenic
1201855625 Y:18537345-18537367 GCTCTCAGGAGACAGAAAGCAGG - Intergenic
1201877696 Y:18783040-18783062 GCTCTCAGGAGACAGAAAGCAGG + Intronic