ID: 1131623114

View in Genome Browser
Species Human (GRCh38)
Location 15:94088485-94088507
Sequence TTGGTCATATAAAGGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131623111_1131623114 -4 Left 1131623111 15:94088466-94088488 CCAAGAAGTTCTATAAAATTTGG No data
Right 1131623114 15:94088485-94088507 TTGGTCATATAAAGGAATCCTGG No data
1131623110_1131623114 13 Left 1131623110 15:94088449-94088471 CCTGCTACACATTTAAACCAAGA No data
Right 1131623114 15:94088485-94088507 TTGGTCATATAAAGGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131623114 Original CRISPR TTGGTCATATAAAGGAATCC TGG Intergenic
No off target data available for this crispr