ID: 1131623411

View in Genome Browser
Species Human (GRCh38)
Location 15:94091661-94091683
Sequence CCTCCTATGCAGGGTCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131623411_1131623415 6 Left 1131623411 15:94091661-94091683 CCATGGAGACCCTGCATAGGAGG No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131623411 Original CRISPR CCTCCTATGCAGGGTCTCCA TGG (reversed) Intergenic
No off target data available for this crispr