ID: 1131623415

View in Genome Browser
Species Human (GRCh38)
Location 15:94091690-94091712
Sequence CGTGTGTTCCTTTTCATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131623413_1131623415 -3 Left 1131623413 15:94091670-94091692 CCCTGCATAGGAGGACTCTGCGT No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data
1131623411_1131623415 6 Left 1131623411 15:94091661-94091683 CCATGGAGACCCTGCATAGGAGG No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data
1131623409_1131623415 17 Left 1131623409 15:94091650-94091672 CCTATAGTATACCATGGAGACCC No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data
1131623405_1131623415 26 Left 1131623405 15:94091641-94091663 CCCATTGTCCCTATAGTATACCA No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data
1131623406_1131623415 25 Left 1131623406 15:94091642-94091664 CCATTGTCCCTATAGTATACCAT No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data
1131623414_1131623415 -4 Left 1131623414 15:94091671-94091693 CCTGCATAGGAGGACTCTGCGTG No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data
1131623408_1131623415 18 Left 1131623408 15:94091649-94091671 CCCTATAGTATACCATGGAGACC No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data
1131623404_1131623415 27 Left 1131623404 15:94091640-94091662 CCCCATTGTCCCTATAGTATACC No data
Right 1131623415 15:94091690-94091712 CGTGTGTTCCTTTTCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131623415 Original CRISPR CGTGTGTTCCTTTTCATTTT AGG Intergenic
No off target data available for this crispr