ID: 1131624326

View in Genome Browser
Species Human (GRCh38)
Location 15:94101595-94101617
Sequence TAAGAAACTTACTTGTCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131624323_1131624326 24 Left 1131624323 15:94101548-94101570 CCTTTCAGCAAATAAATTTAAGA No data
Right 1131624326 15:94101595-94101617 TAAGAAACTTACTTGTCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131624326 Original CRISPR TAAGAAACTTACTTGTCGGC CGG Intergenic
No off target data available for this crispr