ID: 1131624327

View in Genome Browser
Species Human (GRCh38)
Location 15:94101596-94101618
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131624323_1131624327 25 Left 1131624323 15:94101548-94101570 CCTTTCAGCAAATAAATTTAAGA No data
Right 1131624327 15:94101596-94101618 AAGAAACTTACTTGTCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131624327 Original CRISPR AAGAAACTTACTTGTCGGCC GGG Intergenic
No off target data available for this crispr