ID: 1131631752

View in Genome Browser
Species Human (GRCh38)
Location 15:94184559-94184581
Sequence AAACCCTGCTTCACAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131631750_1131631752 20 Left 1131631750 15:94184516-94184538 CCAGTCTACTCAGTAATCTTGTT No data
Right 1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131631752 Original CRISPR AAACCCTGCTTCACAAAGAC AGG Intergenic