ID: 1131634161

View in Genome Browser
Species Human (GRCh38)
Location 15:94212432-94212454
Sequence CTGCTGGATTCAGCCCCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131634161_1131634164 -1 Left 1131634161 15:94212432-94212454 CCATTAGGGGCTGAATCCAGCAG No data
Right 1131634164 15:94212454-94212476 GCACTGCCGGCCTCTCACTCAGG No data
1131634161_1131634168 21 Left 1131634161 15:94212432-94212454 CCATTAGGGGCTGAATCCAGCAG No data
Right 1131634168 15:94212476-94212498 GAGGAAATGCAGCTACTTCGTGG No data
1131634161_1131634165 2 Left 1131634161 15:94212432-94212454 CCATTAGGGGCTGAATCCAGCAG No data
Right 1131634165 15:94212457-94212479 CTGCCGGCCTCTCACTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131634161 Original CRISPR CTGCTGGATTCAGCCCCTAA TGG (reversed) Intergenic
No off target data available for this crispr