ID: 1131634165

View in Genome Browser
Species Human (GRCh38)
Location 15:94212457-94212479
Sequence CTGCCGGCCTCTCACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131634161_1131634165 2 Left 1131634161 15:94212432-94212454 CCATTAGGGGCTGAATCCAGCAG No data
Right 1131634165 15:94212457-94212479 CTGCCGGCCTCTCACTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131634165 Original CRISPR CTGCCGGCCTCTCACTCAGG AGG Intergenic
No off target data available for this crispr