ID: 1131635972

View in Genome Browser
Species Human (GRCh38)
Location 15:94233400-94233422
Sequence CTCTCTGTGTTATACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131635969_1131635972 13 Left 1131635969 15:94233364-94233386 CCAAACAGGGCCAATTAATAAAA 0: 1
1: 0
2: 2
3: 19
4: 220
Right 1131635972 15:94233400-94233422 CTCTCTGTGTTATACATGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 153
1131635968_1131635972 23 Left 1131635968 15:94233354-94233376 CCTGATATATCCAAACAGGGCCA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1131635972 15:94233400-94233422 CTCTCTGTGTTATACATGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 153
1131635970_1131635972 3 Left 1131635970 15:94233374-94233396 CCAATTAATAAAATTGCATATAT 0: 1
1: 0
2: 5
3: 57
4: 676
Right 1131635972 15:94233400-94233422 CTCTCTGTGTTATACATGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131635972 Original CRISPR CTCTCTGTGTTATACATGGA AGG Intronic
901566460 1:10119972-10119994 TTGACCGTGTTATACATGGAAGG - Intronic
904156849 1:28491039-28491061 CTATATGTGTTATATTTGGATGG + Intronic
910054671 1:83018448-83018470 ATCACTGTGTTGAACATGGATGG - Intergenic
910934288 1:92474887-92474909 CCCTCTATGGTACACATGGAGGG + Exonic
911477823 1:98395397-98395419 CTCTTTGTCTCCTACATGGAAGG + Intergenic
913323188 1:117605258-117605280 CTCGCTATGTTATGAATGGATGG + Intergenic
919384185 1:196897983-196898005 TTCTGTGTGGAATACATGGATGG + Intronic
921847681 1:219901379-219901401 TTCTCTGTGTTTTATATTGAAGG - Intronic
923220674 1:231889787-231889809 CTCTCTCTGTAAAACATGTAGGG + Intronic
924139711 1:241009711-241009733 CTCTCACTGTTATACTTGAATGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924281591 1:242443381-242443403 ATCTATGTGTAATACAGGGAGGG + Intronic
1063859567 10:10292831-10292853 CTCCTTGTCTTATACATTGAGGG + Intergenic
1064691781 10:17926177-17926199 CACTTTGTGATATATATGGAGGG - Intergenic
1068662263 10:59634787-59634809 GTCTCTGTGTTATGCATAAATGG - Intergenic
1069183771 10:65396543-65396565 CTCTCTATGTTCTTCATGGATGG + Intergenic
1071236873 10:83658959-83658981 ATCTCTGGCTTATACATGGTTGG + Intergenic
1071978201 10:90976485-90976507 CCCTGTGTGTTATACATTTATGG + Intergenic
1072961522 10:99933673-99933695 CCCTCTGTGTTCTCGATGGATGG + Intronic
1072964807 10:99962686-99962708 CCCTCTGTGTTCTCGATGGATGG - Intronic
1074575939 10:114669359-114669381 TTCTCTGTGGTATCCAAGGATGG - Intronic
1074703231 10:116110334-116110356 GTGTCTGTGTTTTACATGCAGGG + Intronic
1078372277 11:10758449-10758471 CTCTCTGTCTTATACATCATAGG - Intronic
1079783089 11:24634469-24634491 CTCTCTGTGTTATCGATAGCTGG - Intronic
1080541635 11:33271769-33271791 CTTTCTTTTTTATACATTGATGG + Intronic
1080776048 11:35387663-35387685 ATCTCTGTCTTATACATGTATGG - Intronic
1081816705 11:45948591-45948613 TTCACTGTGCTATTCATGGATGG + Intronic
1083799382 11:65037772-65037794 CTCCCTGAGCAATACATGGAGGG + Intronic
1084583911 11:70043276-70043298 CTCTCTGTGTTTTATTTTGAAGG - Intergenic
1089194648 11:116687065-116687087 CTCTAGGTCTTATAGATGGAGGG + Intergenic
1089989224 11:122842851-122842873 ATATCTGTGTTAGACATGGGTGG + Intronic
1090881904 11:130840560-130840582 CTCTCTGTGTTCTAGGGGGATGG - Intergenic
1102468914 12:113148470-113148492 CTCTCTGTGTTACACAGGCTGGG + Intergenic
1103263168 12:119606887-119606909 CACTCTATGTTATAAATAGATGG - Intronic
1105485740 13:20829742-20829764 CTTGCTGTATTATACCTGGAGGG - Intronic
1109205291 13:59476639-59476661 TACTCTGTTTTAGACATGGAAGG - Intergenic
1110459247 13:75726913-75726935 CTCTCTGTATAACACATTGAGGG + Intronic
1113467889 13:110524911-110524933 CTGTCTGTTTTAAACCTGGAGGG - Intronic
1115402517 14:32978364-32978386 CTCTCTGAGTTGTATGTGGATGG - Intronic
1119602560 14:75986257-75986279 CGCACTGTTTTATGCATGGAAGG + Intronic
1120129294 14:80786192-80786214 CTCTCTAAGATTTACATGGAAGG + Intronic
1120554475 14:85912197-85912219 CTCTCTGTGAAAGACTTGGAGGG + Intergenic
1120812516 14:88818804-88818826 CTCTCTGGGTTGTGCATGTATGG - Intergenic
1122563471 14:102633915-102633937 TTCTCTGTATAATACATAGAAGG + Intronic
1125202205 15:37110267-37110289 CACTCTGTGTGATACGTGGCCGG + Intergenic
1126425095 15:48518918-48518940 CTCTCAGTGGTATACCTGGGAGG + Intronic
1127392352 15:58516529-58516551 TTCTCTGTGTTTCAAATGGATGG + Intronic
1130309000 15:82736307-82736329 TTCCCTGTGTTATAAATGAATGG + Intergenic
1130838932 15:87679371-87679393 ATCTCTGTGTTTTAGATGGGAGG - Intergenic
1131635972 15:94233400-94233422 CTCTCTGTGTTATACATGGAAGG + Intronic
1131966763 15:97852649-97852671 CTCTCTGTGTTTGCCATGTAAGG - Intergenic
1137278152 16:46951147-46951169 CTCTCTCTGTTATTCCTGGGAGG + Intergenic
1148575922 17:48711203-48711225 CTTTCTGTGTCATACAGGGCTGG - Intergenic
1149533681 17:57415750-57415772 CTCTCTGTGTGCCAAATGGACGG + Intronic
1150697940 17:67421915-67421937 CTCTCAATGTTATTCCTGGAAGG - Intronic
1152055804 17:78025136-78025158 CTCTTTGTGTTATATATCTATGG + Intronic
1153517189 18:5914890-5914912 CTCTATGTGAGATACAGGGATGG - Intergenic
1153994117 18:10424793-10424815 CTCTCTCTGATCTCCATGGATGG + Intergenic
1154240533 18:12649631-12649653 CTCTGCTTGTTATATATGGAAGG - Intronic
1155398188 18:25408533-25408555 CTAACTGTATTATACATGCATGG - Intergenic
1156290841 18:35747739-35747761 CCCTCTGTGGTAAACAGGGAAGG + Intergenic
1157497889 18:48169474-48169496 CACACTGTGTTGCACATGGAAGG + Intronic
1165071296 19:33256308-33256330 CCCTCTGTGTGAGGCATGGAGGG + Intergenic
1165928366 19:39341462-39341484 CTCTCTGGCTTATACATGGAGGG - Intronic
1167714886 19:51136907-51136929 CTCACTGAGATCTACATGGAAGG + Intergenic
926667935 2:15545267-15545289 CTCTCATTGTTATAGATGGAAGG - Intronic
926897684 2:17712290-17712312 CTCTCTGTTTTAAACATGATAGG - Intronic
927606145 2:24489197-24489219 CTCTCTTTAGCATACATGGATGG + Intergenic
930934880 2:56936608-56936630 CTCTCTGTGGTATACTTGCAGGG - Intergenic
934051901 2:88218271-88218293 CTCTCTGTGTTATACCTGCAGGG - Intergenic
935903940 2:107822918-107822940 CTCTCTATCTTAGAGATGGAGGG - Intergenic
944282698 2:197916099-197916121 TTCTCTGTGTTTTACTTGGTAGG + Intronic
948870976 2:240797916-240797938 CTCCCAGTGTGATACATGCATGG + Intronic
949002677 2:241625597-241625619 TTCACTGTGTTAGCCATGGATGG - Intronic
1171433378 20:25101356-25101378 GTCTCTGTGTGCTTCATGGAAGG - Intergenic
1171902648 20:30871552-30871574 CTCTAGGTATTAAACATGGATGG + Intergenic
1172365768 20:34347840-34347862 CTTTCTGTGTTACCCATGGAGGG - Intergenic
1173936379 20:46869604-46869626 CTCCATGTCTTATACGTGGAAGG + Intergenic
1177318553 21:19492355-19492377 CTTTTGGTGGTATACATGGATGG + Intergenic
1179401546 21:41089241-41089263 CTTTCTGTGTAATAAATAGATGG + Intergenic
1179649337 21:42796713-42796735 CACTCTGTGTTACTCAGGGAGGG + Intergenic
1180336038 22:11577522-11577544 CTCTAGGTATTAAACATGGATGG + Intergenic
1183545069 22:38451029-38451051 GTCCCCGTGTTATAGATGGAAGG - Intronic
949680395 3:6506817-6506839 CTGTCTTTGTTGTACCTGGATGG + Intergenic
950129838 3:10534374-10534396 CTCTCTGTCTGATACTGGGAAGG + Intronic
952203974 3:31160680-31160702 CTGTCTGTCTTCTACATAGAAGG - Intergenic
953527617 3:43706833-43706855 CTTTCCGTTTTATGCATGGAGGG + Intronic
955911957 3:63866080-63866102 CTCTCTGAGTTATTCATAAATGG + Intronic
956005521 3:64774707-64774729 CTGTGTGTCTTTTACATGGAAGG + Intergenic
957012701 3:75026740-75026762 CTATCTGTGTTATATATTGTTGG - Intergenic
957659041 3:83122463-83122485 CTCTCTGTGGTTTGCATGAATGG - Intergenic
960842469 3:121974134-121974156 CTGTGTGTGTTAGACATTGAAGG - Intergenic
961333358 3:126155782-126155804 GTGTCTGTGTTATACCTGCAGGG - Intronic
963698852 3:148598551-148598573 CTCTCTATTTTATTCATGGATGG + Intergenic
966395199 3:179495019-179495041 CTCTTTGAGTTATACCTGAATGG - Intergenic
967199873 3:187063534-187063556 ATCTCTGTTTGATACATGGATGG + Intronic
970013488 4:11486344-11486366 CTCTAAGAGTTTTACATGGATGG + Intergenic
970849415 4:20583484-20583506 CCCTTTGTGTTAAACAAGGAAGG + Intronic
970949876 4:21742222-21742244 CTCTCTATGTAATGCATGGTTGG - Intronic
971182053 4:24337880-24337902 CTCTCTTTGTCATTAATGGATGG - Intergenic
971834035 4:31738173-31738195 CTATCTGTGGAATAAATGGATGG + Intergenic
972574783 4:40341822-40341844 ATCACTTTGTTACACATGGAGGG - Intronic
972622629 4:40763283-40763305 CTCTCTGTGTTAAATAAGTAAGG + Intronic
973588492 4:52416282-52416304 ATGTCTGTGTTATACATAGAAGG + Intergenic
980989283 4:139725064-139725086 CTCTCTCTATTAGAGATGGAAGG + Intronic
981723707 4:147826350-147826372 GTCTCTGTGTTAGACAAGGTTGG + Intronic
984053481 4:174896566-174896588 CTCTCTGTTTTCTAAAGGGAAGG - Intronic
984383752 4:179029803-179029825 CTCTCTCTGGTCTCCATGGATGG + Intergenic
986315616 5:6584486-6584508 CTCTCTGTGTTCTCCCTGGAAGG + Intergenic
987843658 5:23254270-23254292 CTCTGTGTTTTATTCATGTAAGG - Intergenic
996298920 5:121958750-121958772 CTCCCTGTTTTATTCATGGAGGG - Intergenic
998030781 5:138865916-138865938 CTCGCTGTCAAATACATGGAGGG - Intronic
999773297 5:154791621-154791643 TTTCCTGTGTTATACATGGCGGG + Intronic
1000016785 5:157285086-157285108 CCCTCTGTGATCAACATGGAAGG - Intronic
1001989884 5:176107643-176107665 CTCTGTGTGTTTTACATTAATGG - Intronic
1005533490 6:26732093-26732115 CTCTTTGTGTTATACATCCTGGG - Intergenic
1005535160 6:26747582-26747604 CTCTTTGTGTTATACATCCTGGG + Intergenic
1005537304 6:26769561-26769583 CTCTTTGTGTTATACATCCTGGG + Intergenic
1005894201 6:30163985-30164007 CTCTGTGTGTTCTGCAGGGAGGG + Exonic
1009006183 6:57791024-57791046 CTCTTTGTGTTATACATCCTGGG + Intergenic
1009008188 6:57811990-57812012 CTCTTTGTGTTATACATCCTGGG + Intergenic
1011025675 6:82866835-82866857 CTCTCTGTGTTCTTCTTTGAGGG - Intergenic
1012632493 6:101489387-101489409 CTCTCTGTGTTTTAAATGAATGG - Intronic
1013531202 6:111020348-111020370 CCCTCTGTGTTAAACATAGAGGG + Intronic
1015473473 6:133633242-133633264 CTGTCAGTGTTTTAAATGGAGGG + Intergenic
1016423113 6:143905681-143905703 CTCTGTGGGTTTTACATGTATGG + Intronic
1016656941 6:146529606-146529628 GTCTCTGTCTTATATATGGGAGG - Intergenic
1018148820 6:160919740-160919762 ATCTCTGTTTTATTCATGGTGGG - Intergenic
1020697681 7:11435319-11435341 CTATCTATGTTATTCATGGTGGG + Intronic
1020715117 7:11664812-11664834 CTCTCAAGGTTATCCATGGATGG - Intronic
1021505181 7:21375879-21375901 TTCTCTGTAATATATATGGAGGG + Intergenic
1021567084 7:22026565-22026587 CTACCTGTGTTGTACATCGAAGG - Intergenic
1022537604 7:31107580-31107602 CTCTCTGTGGTGTGCATGGTTGG - Exonic
1023523088 7:41068523-41068545 CTCTCTGCTTTATACATACAAGG + Intergenic
1033911617 7:146269954-146269976 CTGTCTTTGTTAAACATGGGAGG + Intronic
1036739897 8:11350516-11350538 CTCTCTGGGTTGGTCATGGAAGG - Intergenic
1037053027 8:14401059-14401081 CTCCCTGTGTAATTAATGGAAGG + Intronic
1038932477 8:32209900-32209922 GTCTCTTTGTTATACAGGAAAGG + Intronic
1039196172 8:35034102-35034124 CCCTCTGTGTGTTAGATGGATGG - Intergenic
1039459207 8:37729269-37729291 CTCACTGTGTTATCCAGGGCAGG - Intergenic
1044693405 8:94900225-94900247 CTCTTTGTGGGATAAATGGAGGG + Intronic
1045539645 8:103071322-103071344 CTCCCCGTGTTGTTCATGGAGGG + Exonic
1048850278 8:138638561-138638583 CTCTCTGTGATATATTGGGAGGG + Intronic
1050197047 9:3096333-3096355 GTCTCTGTAAAATACATGGAAGG - Intergenic
1050226271 9:3459896-3459918 TTATCTATGTTATCCATGGATGG + Intronic
1050664902 9:7924815-7924837 CTCACTGTGTCATACATGCCAGG + Intergenic
1050797936 9:9568594-9568616 CTCACTGAGTCATACATGTATGG + Intronic
1050822880 9:9904133-9904155 CTCTCTGTGTCAGACAAAGATGG + Intronic
1051331662 9:16030316-16030338 CTCTGTGTGTTTTATATGAATGG + Intronic
1055291786 9:74789088-74789110 CTTTCTGTGTTTAAGATGGAGGG - Intronic
1056292545 9:85158275-85158297 CTCTCTCTGTTAAATATGGCTGG - Intergenic
1056810239 9:89758192-89758214 CTCACTTGGTTATACATGTAAGG + Intergenic
1056902421 9:90612454-90612476 TCCTGTGTGTTATACATCGAGGG - Exonic
1057575566 9:96239640-96239662 CTCTCTCTGTCTTTCATGGATGG - Intronic
1059824314 9:118009920-118009942 CTCTCTGTGTTAAATATTCATGG + Intergenic
1060426297 9:123509531-123509553 CTCTCTGGGTCACAGATGGATGG + Intronic
1060876955 9:127090479-127090501 GTGTCTGTGTGATACAGGGATGG + Intronic
1186505498 X:10088686-10088708 CTCACTGGGATATTCATGGAAGG - Intronic
1187717098 X:22113638-22113660 CTCCCTGTGTTGTTCATGGTGGG + Intronic
1189193062 X:39127830-39127852 ATCTCTGTGTTTTCCATGAAAGG - Intergenic
1189564549 X:42228048-42228070 CTTTCTGTGATTTACTTGGAGGG + Intergenic
1189845379 X:45131702-45131724 CTCTCTGTCTTTTCCATGTAAGG + Intergenic
1192339413 X:70250794-70250816 TTGTCTGTGTTCTACATGGGAGG - Intergenic
1194679563 X:96835745-96835767 TTCTCTGTGTTGTACATGGGAGG + Intronic
1194715063 X:97278368-97278390 CTCTATATGTTATACATATATGG + Intronic
1195572650 X:106413872-106413894 TTGTCTTTGTCATACATGGAAGG + Intergenic
1197530270 X:127615449-127615471 CTTTCCGTGTTCTACATGTAAGG - Intergenic
1198588823 X:138153408-138153430 TTTTCTGTGTTATAAATGAAAGG - Intergenic
1198787384 X:140303842-140303864 CTATCTGTCTCATACATTGATGG + Intergenic