ID: 1131638507

View in Genome Browser
Species Human (GRCh38)
Location 15:94263572-94263594
Sequence CTGGTGTTCCTAAGGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131638507_1131638510 1 Left 1131638507 15:94263572-94263594 CCTTCTGTCCTTAGGAACACCAG 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1131638510 15:94263596-94263618 CAACACTACAGCTTTATGCTAGG 0: 1
1: 0
2: 2
3: 12
4: 172
1131638507_1131638511 2 Left 1131638507 15:94263572-94263594 CCTTCTGTCCTTAGGAACACCAG 0: 1
1: 0
2: 2
3: 19
4: 215
Right 1131638511 15:94263597-94263619 AACACTACAGCTTTATGCTAGGG 0: 1
1: 0
2: 1
3: 16
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131638507 Original CRISPR CTGGTGTTCCTAAGGACAGA AGG (reversed) Intronic
900616435 1:3567660-3567682 CAGGTGCTCCTAGGGACCGAGGG - Intronic
902551815 1:17223866-17223888 CTTGTGGTCCTAAGGACTGCTGG - Intronic
906580196 1:46929789-46929811 TTGGTGTTCCAAAGGCCACAAGG + Exonic
906603527 1:47149101-47149123 TTGGTGTTCCAAAGGCCACAAGG - Exonic
906966326 1:50460419-50460441 CTAGTGTTCCTAAGTAAAGGAGG + Intronic
910248513 1:85168435-85168457 CTGTTGTTCCTTAGAATAGAAGG - Intronic
910897797 1:92086290-92086312 TTGGTGTTCCAAAGGCCACAAGG + Intronic
911213548 1:95167541-95167563 TTGGTGTTCCAAAGGCCACAAGG - Intronic
911417108 1:97588696-97588718 CTGGTTTCCCTAAGGACCCATGG + Intronic
911557567 1:99363510-99363532 CTAGAGTCCCCAAGGACAGAAGG + Intergenic
914768161 1:150658183-150658205 CGGGTGTTGCTAATGACAGTTGG - Intronic
915294127 1:154908203-154908225 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
915401246 1:155623540-155623562 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
916518317 1:165540917-165540939 CTGGTGATCCAAAGGACAGGTGG - Intergenic
916621693 1:166504788-166504810 CTGGTGTTCTTTTGCACAGAAGG + Intergenic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
920974779 1:210775536-210775558 CTCCTTTTCCTAAGGAGAGAAGG + Exonic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921661951 1:217813727-217813749 CTAGTCTTTCTAAGGACAGTAGG + Intronic
921678954 1:218008750-218008772 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
922028912 1:221779691-221779713 CTGGACCTCCTAAGGACACAAGG + Intergenic
922691524 1:227696005-227696027 CTGGACTTCCAAAGGAAAGATGG - Intergenic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923509725 1:234639917-234639939 CAGATCTTCCTAAGGAAAGAGGG - Intergenic
1063201222 10:3786074-3786096 CTGGTGGCCCGGAGGACAGAGGG - Intergenic
1068530398 10:58179650-58179672 CTAGTGTTCCTAAGTGTAGAAGG + Intergenic
1069657589 10:70101501-70101523 TTGGTGTTCCAAAGGCCACAAGG + Intronic
1069941010 10:71955263-71955285 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
1069955196 10:72046032-72046054 CAGGTGTTCCCCTGGACAGATGG - Intergenic
1070342184 10:75507821-75507843 CTTCTGTGCCTAAGGACAAATGG - Intronic
1070581440 10:77723315-77723337 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
1071508524 10:86247095-86247117 CTGATGGTCAGAAGGACAGATGG + Intronic
1073875768 10:107920114-107920136 TTGGTGTTCCAAAGGCCACAGGG + Intergenic
1075479072 10:122763793-122763815 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
1075629683 10:123993679-123993701 TTGGGGTTCCAAGGGACAGAGGG - Intergenic
1076152641 10:128175144-128175166 CTGGTGTTCCAAAGGCCATGAGG + Intergenic
1076940478 10:133603629-133603651 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
1077954048 11:6994047-6994069 CTAGTGTTCCTAAGTACAAGAGG + Intergenic
1078825181 11:14923086-14923108 CTTGTCTTCCTAAGGAAAGTAGG - Intronic
1079728183 11:23903631-23903653 CTAGTGTTCATAAGCACAGTAGG + Intergenic
1079753707 11:24229585-24229607 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
1081277205 11:41164790-41164812 TTGGTGTTCCAAAGGCCACAAGG - Intronic
1083594314 11:63911779-63911801 CTGGTGTCACTGAGGACAGAAGG - Exonic
1083860446 11:65417514-65417536 CTGGCGGTCCTGAAGACAGAGGG + Intergenic
1084196802 11:67527372-67527394 CTGGTGTTTAAATGGACAGATGG + Intergenic
1085084234 11:73656051-73656073 CTGGTGTGGCTGGGGACAGAGGG - Intronic
1086748081 11:90455447-90455469 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089901629 11:121992601-121992623 CAGGAGCTCCCAAGGACAGATGG - Intergenic
1091265205 11:134265195-134265217 CTTGTTTTCCTAATGCCAGAAGG + Exonic
1092060838 12:5549029-5549051 CTGGTGCTCCTTAGGACTGGAGG - Intronic
1095549748 12:43420592-43420614 CTGTTGCTCCTAAGGCCAGCAGG - Intronic
1095859948 12:46905599-46905621 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
1095952315 12:47788284-47788306 CTGGGGTTCCTAAAGCCACACGG + Intronic
1097021192 12:56021784-56021806 TTGGTGTTGCTAAGCAAAGACGG + Intronic
1097222835 12:57460898-57460920 CCGGTGGTCCTGAGGTCAGAGGG - Intronic
1100390306 12:94141417-94141439 CTGGTGTCACTGAGGACGGAAGG + Intergenic
1100708677 12:97229809-97229831 CTGGTGTTCTTAAGCACAGAAGG - Intergenic
1101452554 12:104793188-104793210 ATGGTGTTGGTAAGGTCAGATGG + Intergenic
1101475819 12:105047245-105047267 ATTCTGTTACTAAGGACAGAGGG - Intronic
1101954782 12:109203663-109203685 CTGGTGGTCCTGAGGACAGGGGG - Intronic
1102596898 12:113999759-113999781 ATGGTTTTTCTCAGGACAGAGGG + Intergenic
1103547146 12:121710445-121710467 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
1104642398 12:130475843-130475865 CAGGTGTTGGTGAGGACAGAGGG + Intronic
1105994378 13:25656135-25656157 ATGGTGTTCCTGAGTACTGATGG - Intronic
1111638444 13:90935664-90935686 CTGGTTTTCCTCTGGACACATGG - Intergenic
1111865387 13:93761933-93761955 CTGGTGTTCTATTGGACAGATGG - Intronic
1113060635 13:106318966-106318988 CATGTGTTCCTAAGAAAAGAGGG - Intergenic
1113139882 13:107135442-107135464 GTGATGTTATTAAGGACAGAAGG - Intergenic
1113575592 13:111393173-111393195 CTGTAGTTCATAAGGAGAGAGGG - Intergenic
1114054609 14:18956614-18956636 TTGGTGTTTCAAAGGTCAGATGG + Intergenic
1114107945 14:19445317-19445339 TTGGTGTTTCAAAGGTCAGATGG - Intergenic
1114573961 14:23695583-23695605 CTCCTGTTCCTAAGGCCAGCGGG - Intergenic
1115307207 14:31945221-31945243 CAAGTGTGCCTGAGGACAGAGGG + Intronic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1118055994 14:62080440-62080462 CTTGTGTCCCTAAATACAGATGG - Intronic
1119311146 14:73647702-73647724 CTGGTTTTCCTATGGATAGAAGG - Intronic
1121301846 14:92878089-92878111 CTGGAGTTTGGAAGGACAGATGG - Intergenic
1121382078 14:93480916-93480938 GTGGTGTTCCTAATGTCAGATGG + Intronic
1121975686 14:98402031-98402053 CTGGAGTTCATCAGGATAGAGGG - Intergenic
1122836492 14:104433344-104433366 GTGGAGTTGCTGAGGACAGATGG + Intergenic
1125573741 15:40740710-40740732 CTGGGGTTTCTAATGACAGATGG - Intronic
1126765974 15:52011432-52011454 ATAGAGTTCCTAAGCACAGAAGG + Intronic
1127252232 15:57251592-57251614 CTGATGTCCCAAAGAACAGATGG - Intronic
1127448299 15:59088873-59088895 CTAGTGTTCCTAAGCAAAGAAGG - Intronic
1128302604 15:66576013-66576035 CAGGTGTACATAAGGACACAGGG - Intergenic
1129269096 15:74410148-74410170 CTGGTGTTCCTGAAGACCCAGGG - Exonic
1130407186 15:83612528-83612550 GTGGTGTCACTAAGTACAGATGG - Intronic
1131326168 15:91448257-91448279 CTTGTATTCCAAAGGACACAGGG + Intergenic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1132219134 15:100092030-100092052 CTGGTGTCCCTACAGGCAGAGGG - Intronic
1134781214 16:16897226-16897248 CTGGTGTTCCTTTGCACAGTTGG - Intergenic
1137723846 16:50643885-50643907 CTTGTGCTCTTAAGCACAGAAGG - Intergenic
1138627103 16:58261163-58261185 CTGATGTGCCCAAGGAGAGAGGG + Intronic
1140601673 16:76483588-76483610 CGAGTGCTCCTAAGCACAGAAGG - Intronic
1141264181 16:82481088-82481110 GTAGTGTTCCTAAGCACAGAAGG + Intergenic
1144275802 17:13667077-13667099 CTGCTGTGCCTGAGGTCAGATGG - Intergenic
1144280425 17:13720740-13720762 ATAGTGTTTCTGAGGACAGAAGG - Intergenic
1147985797 17:44307492-44307514 GGGATGTTCCTAAGGGCAGATGG + Intergenic
1149623078 17:58060594-58060616 CTCATGTTGCTGAGGACAGATGG - Intergenic
1149634797 17:58157792-58157814 CTGGTCTTCCTTAGGACAGGTGG - Intergenic
1153025210 18:666499-666521 CTGCTTTTCCTAGGGACAGGTGG - Intronic
1154160252 18:11976052-11976074 CTGGTGTTCTTATGAAAAGAGGG - Intergenic
1159760549 18:72420249-72420271 CTGGTGGTCCAAAGGCTAGAAGG + Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160385639 18:78494742-78494764 CTGGTGTCCCTGAAGGCAGATGG + Intergenic
1160845780 19:1165414-1165436 CTGCTGTCCCTGAGAACAGAAGG + Intronic
1162593182 19:11606552-11606574 CTGGGGTTCTTGAGGACGGATGG + Intronic
1164599557 19:29551768-29551790 CTGGTACTCCTTAGGACAGGAGG + Intronic
1165602333 19:37065288-37065310 TTGGTGTTCCAAAGGCCACAAGG + Intronic
1165764072 19:38339388-38339410 TTGGTGTTCCAAAGGCCACAAGG + Intronic
1167207256 19:48110901-48110923 CTCGGGTGCCTAATGACAGAAGG - Intergenic
1167735162 19:51289992-51290014 ATAGTTTTCCTAAGGACAGGTGG - Intergenic
1167749616 19:51371872-51371894 TTGGGGTCCCTGAGGACAGAGGG - Intronic
1168278064 19:55287876-55287898 CTGGTGACCCAAAGGACAGCTGG + Intronic
1168279750 19:55298809-55298831 CTGGTGTTCCTAAGCGCGGGAGG + Intronic
924997916 2:380870-380892 CTGGGGTTCCTAGGCACAGTGGG + Intergenic
925179577 2:1808346-1808368 CTGGTGTTCCTAAGGGCAGGGGG - Intronic
926079473 2:9972791-9972813 CTGGTGAACCTAAGGACACTTGG - Intronic
926174476 2:10577407-10577429 CTGGTGTTCCAAGGGAGACAGGG - Intronic
927361730 2:22243259-22243281 TTGTTGTTCCTATTGACAGATGG + Intergenic
928370712 2:30738285-30738307 CTGGAGGTCCTGAGGAGAGAAGG + Exonic
929788494 2:45008202-45008224 CTGGTCATCCTCAGGACAGAGGG - Intronic
930301776 2:49625238-49625260 ATGGTGTTCCTATTCACAGAGGG - Intergenic
931521690 2:63105068-63105090 CTGGTGTCCCCAAGGGCAAAGGG - Intergenic
934628256 2:95883800-95883822 ATCGTGTTCCTAAAAACAGACGG - Intronic
935722228 2:105989731-105989753 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
935982275 2:108639074-108639096 CTGGTGTTCTTAAGGAGATGAGG + Intronic
936181410 2:110270858-110270880 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
936199962 2:110398574-110398596 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
937213392 2:120293283-120293305 CAGCTGCTCCTAAGGACACAGGG + Exonic
938472625 2:131579470-131579492 TTGGTGTTTCAAAGGTCAGATGG + Intergenic
939616261 2:144364793-144364815 CTTGTGTTCAAAAGGGCAGAAGG - Intergenic
940584297 2:155625269-155625291 CTGTTCTTCCTCAGGGCAGAGGG - Intergenic
941244995 2:163085470-163085492 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
942919826 2:181359025-181359047 ATGGTGTTCCTAATGAAAGATGG + Intergenic
943041855 2:182813342-182813364 GTCGTGTTCCAAAGGACAGGGGG - Intergenic
945175678 2:207041026-207041048 CTGGTGTTCCTGAGACCACAGGG - Intergenic
946882700 2:224192428-224192450 ATGGTGGTCCTAAGAAGAGAGGG + Intergenic
948251933 2:236536280-236536302 GTGGTCTGCCTGAGGACAGAAGG + Intergenic
948924239 2:241083649-241083671 CTGGTGTAACTAAGCACAGCGGG - Intronic
1170903538 20:20489425-20489447 GTGGTGTTACTAAAGATAGAAGG - Intronic
1173848543 20:46203120-46203142 CAGCTGTTCCTAAGGCCATAGGG + Intronic
1175651534 20:60728867-60728889 CTGGCATTCTTCAGGACAGAAGG - Intergenic
1176790754 21:13316548-13316570 CTTGTCTTCCTAAGGAAAGCAGG - Intergenic
1180244776 21:46539642-46539664 CTGGTGCTCCAAAGGGCAGAAGG - Intronic
1180473078 22:15679006-15679028 TTGGTGTTTCAAAGGTCAGATGG + Intergenic
1180526819 22:16273771-16273793 CTGGTTCTCCTAAAGAAAGATGG - Intergenic
1181263515 22:21615945-21615967 CTAGTATTCCTGAGCACAGAAGG + Intronic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1182302922 22:29348417-29348439 CTAGTGTCCCCAAGCACAGAAGG + Intronic
1183774229 22:39952590-39952612 CTGGTGTCACTAAGGACATGTGG - Intronic
1184247898 22:43244928-43244950 CTGTTGATTCTAGGGACAGAAGG - Intronic
950777602 3:15364152-15364174 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
952109309 3:30104177-30104199 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
953386569 3:42509657-42509679 CAGGAGTTCCTAAGCCCAGAAGG + Intronic
953981410 3:47414985-47415007 CTGGGGTCCCTGAGGACAAAAGG + Exonic
954115147 3:48462998-48463020 CTGCAGTTTCTAAGCACAGAAGG - Intronic
954966634 3:54617335-54617357 ATGGGTTTTCTAAGGACAGAGGG - Intronic
956410909 3:68978427-68978449 CAGTTGTACCTAAGGACACAAGG + Exonic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961724803 3:128920675-128920697 TTGGTGTTCCAAAGGCCACAAGG - Intronic
962395860 3:135014975-135014997 CTTTTGTTCCTAAAGACAGGGGG - Intronic
963625952 3:147672628-147672650 ATGTTGCTCCTAATGACAGATGG - Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
966293666 3:178391014-178391036 CTGGTGTTCATTAGCACAGTAGG + Intergenic
968864464 4:3198972-3198994 CTGGGCTTGCTAAGGACTGAGGG - Intronic
969351358 4:6599838-6599860 CTGGTGTTCCTGAGGCCAGGGGG - Intronic
970445454 4:16120329-16120351 GGGGTGTTTGTAAGGACAGAGGG - Intergenic
974561163 4:63521187-63521209 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
981111431 4:140938806-140938828 CTCCTGTCCCCAAGGACAGATGG - Intronic
981703913 4:147639618-147639640 CTGGGGATCCTAATGCCAGATGG - Intronic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
984355030 4:178647077-178647099 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
984548005 4:181129872-181129894 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
984566513 4:181337045-181337067 TTGCTCTTCCTAAGCACAGATGG - Intergenic
987956438 5:24747869-24747891 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
987956875 5:24751591-24751613 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
988467347 5:31503154-31503176 CTGGGGTGGCTAAGGACAGAGGG - Intronic
992169922 5:74091526-74091548 CTGGTGTTCTGTAGCACAGATGG - Intergenic
999029341 5:148273825-148273847 CTGGTGTTGCCTGGGACAGAGGG - Intronic
1000702627 5:164472491-164472513 CTGATGTTTATAAGGACACAAGG - Intergenic
1001293491 5:170483041-170483063 CTTTTGTTTCCAAGGACAGATGG + Intronic
1001505528 5:172276640-172276662 ATTATGTTCCTTAGGACAGATGG + Intronic
1001823762 5:174729571-174729593 CTGGTCTTCCTTAGGACAGGTGG - Exonic
1005593420 6:27352444-27352466 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
1013739319 6:113264874-113264896 CTGGTGTTGCTCATGACAGTTGG + Intergenic
1014477816 6:121896102-121896124 TTGGTGTTCCAAAGGCCACAGGG + Intergenic
1017044582 6:150335026-150335048 CTTGTGTTCCTATGGATTGATGG - Intergenic
1017693951 6:156995163-156995185 CAGGTGTACCTGAAGACAGACGG + Intronic
1019085859 6:169476154-169476176 TTGGTGTTCCAAAGGCCACAAGG - Intronic
1019951159 7:4373868-4373890 CTGGTGTTTGTAAGGACAACAGG + Intergenic
1023353145 7:39340034-39340056 TTGGTGCTCCTAGGGGCAGACGG - Intronic
1023388458 7:39684012-39684034 CTGGTGTTCCTAAATACATCAGG - Intronic
1023819012 7:43969988-43970010 CTGGTATCCCCAATGACAGATGG + Intergenic
1024491565 7:49991310-49991332 CTGATGTTCCTAACAAGAGAGGG - Intronic
1024942825 7:54780043-54780065 CTGGTCTCCCTAAGCTCAGAAGG + Intergenic
1027623444 7:80520736-80520758 CTTGTGTCCCTAAGGTCACAAGG - Intronic
1027837432 7:83263481-83263503 TTGGTGTTCCAAAGGCCACAAGG - Intergenic
1028112008 7:86951919-86951941 CTAGTGTTCCTAAGTACAAGAGG - Intronic
1029744065 7:102506948-102506970 CTGGTATCCCCAATGACAGATGG + Intronic
1029762055 7:102606111-102606133 CTGGTATCCCCAATGACAGATGG + Intronic
1032667007 7:134046786-134046808 CTGGTGTTTAGAAGGACAGCTGG - Intronic
1032796010 7:135276772-135276794 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1034442102 7:151090999-151091021 CAGGTGTGCCTAAGGGCTGAGGG - Intronic
1034979059 7:155464404-155464426 CTGGTCTCCCTGAGGACTGAGGG + Exonic
1039275597 8:35931847-35931869 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
1040110551 8:43565265-43565287 TTGGTGTTCCAAAGGCCATAAGG - Intergenic
1040706635 8:50136565-50136587 CAGGTGTTTCTCAGGACAAAAGG - Intronic
1041479391 8:58300877-58300899 CTAGTGTTCCTAAGCACAAGAGG - Intergenic
1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG + Intergenic
1042114613 8:65416854-65416876 CTGGTGTTCTTCAAGCCAGATGG + Intergenic
1044846888 8:96390565-96390587 CTGGAATTGCTAAGGCCAGAGGG + Intergenic
1045009293 8:97943756-97943778 CTTGTGCTCCTAAGAAGAGAAGG - Intronic
1046760052 8:118011352-118011374 CTGGTGTTCATAAGGTTAGTGGG - Intronic
1049383802 8:142330929-142330951 TCGGTGTCCCTAAGGACTGAAGG + Exonic
1050120114 9:2299343-2299365 TTTGTGTTGCTAAGGACAGCGGG - Intergenic
1050144896 9:2556518-2556540 TTGGTGTTCCAAAGGCCACAAGG + Intergenic
1051026515 9:12619233-12619255 CTAGTGTTCCTAAGCTCAAAAGG - Intergenic
1051676598 9:19564650-19564672 CTGATTTCCCTAAGGACAGAAGG + Intronic
1057115075 9:92513218-92513240 CTGGTGGTCCTATGGAAACATGG + Intronic
1057256891 9:93557052-93557074 CTGGTGTTCCTAAATGCATAAGG - Intronic
1057452665 9:95178540-95178562 GTCGTGTTCCTTAGCACAGAGGG - Intronic
1058119564 9:101123886-101123908 TTGGTGTTCCAAAGGCCACAAGG + Intronic
1058293008 9:103266705-103266727 ATGCTGTTTCTAGGGACAGAAGG + Intergenic
1059299384 9:113299908-113299930 ATGGTTTTCGTAAAGACAGAAGG + Intronic
1060065595 9:120497839-120497861 TTGGTGTTCCAAAGGCCACAGGG - Intronic
1060904283 9:127290979-127291001 CTTGGGTTCCCAAGGACAGTGGG + Intronic
1062445384 9:136591719-136591741 CTTGTGTGCCAGAGGACAGACGG + Intergenic
1186316176 X:8373257-8373279 CTGGTGTTCCAAAGGCCACGAGG - Intergenic
1188673973 X:32915563-32915585 GTGGTGGTACTAAGGAGAGAGGG - Intronic
1191090541 X:56616213-56616235 TTGGTGTTCCAAAGGCCAGGAGG + Intergenic
1192684931 X:73293907-73293929 TTGGTGTCCCTAAAGACATAGGG + Intergenic
1199074423 X:143512480-143512502 CTGGCTTTCCAAAAGACAGACGG + Intronic
1199093428 X:143715748-143715770 CTGGCTTTCCAAAAGACAGACGG + Intronic