ID: 1131640497

View in Genome Browser
Species Human (GRCh38)
Location 15:94287676-94287698
Sequence AAGCTACAGCTTCGACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131640497 Original CRISPR AAGCTACAGCTTCGACAAAC AGG Intronic
901833742 1:11910165-11910187 AAGCTCCAATTTTGACAAACTGG + Intergenic
909843106 1:80355201-80355223 AAGCTACTGTTTAGAGAAACTGG - Intergenic
913006521 1:114637881-114637903 AATCTACAGATTCAACAATCTGG - Intronic
916877988 1:168990822-168990844 AAGCTGCAGCTTGGATCAACAGG - Intergenic
919994230 1:202733328-202733350 AAGCTACAGGTTCGAGAGAAAGG + Intronic
920080354 1:203368556-203368578 AAGAAACAGCTTCCAGAAACGGG + Intergenic
923732408 1:236565162-236565184 AAGTTACTGCCTCGCCAAACAGG + Intronic
1070069415 10:73072589-73072611 AAGATACAGTTTCTAGAAACTGG - Intronic
1081604012 11:44515591-44515613 CAGCTACAGCTTCGAGAATGTGG + Intergenic
1087069636 11:94065118-94065140 AAGCTACTGCTTTGCAAAACAGG - Intronic
1088727220 11:112649922-112649944 AAGCTACATTTTTGAAAAACAGG + Intergenic
1092455722 12:8640887-8640909 AGGCTACACCTTAGAAAAACTGG - Intronic
1096760849 12:53840668-53840690 AAGCTCTATCTTCCACAAACTGG + Intergenic
1098219417 12:68252739-68252761 AAGCTACAGTTGTGACGAACAGG - Intronic
1102760890 12:115383982-115384004 AAACTACACCTACAACAAACTGG + Intergenic
1103256414 12:119545187-119545209 GAGCTACAGCTATGAGAAACAGG - Intergenic
1103608617 12:122107088-122107110 AAGCTACAGAGTGGACAACCTGG - Intronic
1105475091 13:20721885-20721907 CAACTCCAGCATCGACAAACAGG + Exonic
1108595007 13:51942086-51942108 AAGCTACAGAGTAGACAGACGGG - Intronic
1111116724 13:83788185-83788207 AAGAAACAGCTTCCACATACAGG - Intergenic
1112535504 13:100250547-100250569 AAGTTACAGCTATTACAAACAGG - Intronic
1122182770 14:99967916-99967938 AAGCTCCAGCTTTGACCCACAGG + Intergenic
1125529079 15:40399686-40399708 AAGGAACAGCTTCCACAACCTGG - Intergenic
1126131544 15:45346802-45346824 GATCTACAGCTTCTACTAACTGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127159111 15:56162219-56162241 AAGTTACAGCCTTAACAAACAGG + Intronic
1127659641 15:61088394-61088416 AAGCCACAGCTGCAAGAAACGGG + Intronic
1127659750 15:61089364-61089386 AAGCTACATCTGTGAGAAACAGG - Intronic
1129811406 15:78513601-78513623 AAGCTACAGCGTCATCAAAGTGG + Intronic
1131640497 15:94287676-94287698 AAGCTACAGCTTCGACAAACAGG + Intronic
1134810076 16:17160048-17160070 AAGCTAGACCTTCGAGAAGCAGG + Intronic
1139828020 16:69772882-69772904 AAGTTTCAGTTTCGACACACTGG + Intronic
1140465491 16:75178333-75178355 AAACTACAGCTTAGACCAAATGG + Intergenic
1147622776 17:41878900-41878922 AAGCTCCAGCATGGCCAAACTGG + Exonic
1155071495 18:22320807-22320829 AGGCTACAGCTTTGGGAAACAGG + Intergenic
936501331 2:113068978-113069000 GAGTTACAGCTTAGACATACAGG - Intronic
1173416995 20:42865742-42865764 AAGCAACAGCTCCAACAAAGAGG + Intronic
1174474189 20:50784303-50784325 CAGCTCCAGCTTCTTCAAACTGG + Intergenic
1180928271 22:19571054-19571076 AAGCCTCAGCTCAGACAAACAGG - Intergenic
949156243 3:830352-830374 AAGCTTCTGCTTGGACATACAGG + Intergenic
952460962 3:33525735-33525757 TAGCTACAGCTCCGGCAAAGTGG + Intronic
956760749 3:72441980-72442002 AAGCTACAACTGCAAAAAACTGG + Intronic
956906335 3:73769633-73769655 GAGCTACAGTTACAACAAACTGG + Intergenic
957336999 3:78843561-78843583 AACCTTCAGCTGAGACAAACAGG - Intronic
959988019 3:112598661-112598683 ATCCTAAAGCTTGGACAAACTGG - Intergenic
966567613 3:181400742-181400764 AAGCAGCAGCTTGGACAAAGAGG + Intergenic
967755018 3:193159120-193159142 AAGCTACAGCATCTGCAAGCTGG - Intergenic
983015811 4:162610123-162610145 AGGCTACAGCCTTGATAAACAGG + Intergenic
999875925 5:155805696-155805718 AAGCTACAGCTGTGACATATGGG + Intergenic
1004543671 6:16575484-16575506 TAGCTACAGCTTAGAATAACTGG - Intronic
1006277375 6:33016059-33016081 AGGCTGCAGCCTCGCCAAACTGG - Intergenic
1011245605 6:85318254-85318276 AAGCTTCTGCCTGGACAAACGGG - Intergenic
1013805807 6:113994447-113994469 AATCTAAAGGTTTGACAAACTGG - Intronic
1023037919 7:36149110-36149132 AAGCTTCATCTTCTACACACAGG - Intergenic
1026570246 7:71523053-71523075 AAGCTAAAACTTAGCCAAACTGG + Intronic
1032608578 7:133386370-133386392 AAGCAACACCTTCTAAAAACAGG - Intronic
1036652013 8:10650359-10650381 AAAATACAGCTTCGACCAAAGGG + Intronic
1052009407 9:23388256-23388278 AAGCTACAGTTTATACACACTGG - Intergenic
1053531459 9:38886348-38886370 AAACTACAGCTTGGACAACTAGG - Intergenic
1054203683 9:62110776-62110798 AAACTACAGCTTGGACAACTAGG - Intergenic
1054634679 9:67477588-67477610 AAACTACAGCTTGGACAACTAGG + Intergenic
1055239339 9:74164570-74164592 TAGCTACAGCATCAACAAAAAGG + Intergenic
1188349453 X:29109972-29109994 AAGGTACATCTTAGACAAAATGG - Intronic
1196092756 X:111763932-111763954 AAGCTACATCTCCCACACACAGG - Intergenic