ID: 1131640619

View in Genome Browser
Species Human (GRCh38)
Location 15:94288673-94288695
Sequence ATGTTAACTCACATGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1187
Summary {0: 1, 1: 0, 2: 25, 3: 232, 4: 929}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131640616_1131640619 17 Left 1131640616 15:94288633-94288655 CCAAGGTATAATTTATATTGGTT 0: 1
1: 0
2: 1
3: 21
4: 291
Right 1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG 0: 1
1: 0
2: 25
3: 232
4: 929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131640619 Original CRISPR ATGTTAACTCACATGGGAAA AGG Intronic
900636186 1:3666931-3666953 ATGTTATTTCCCATGGCAAAGGG + Intronic
902113685 1:14103802-14103824 ATGATACCTTACATGGCAAAGGG - Intergenic
902114805 1:14112617-14112639 ATGTTCCCTTACATGGAAAAAGG + Intergenic
902934831 1:19757511-19757533 ATGTTACCCTACATGGCAAAAGG - Intronic
903316981 1:22515730-22515752 ATGTTACCATACATGGCAAAAGG - Intronic
903376921 1:22872431-22872453 ATGTTACCTTACATGACAAAAGG - Intronic
903489831 1:23719925-23719947 ATGTTATCTTACATGGCAAGGGG - Intergenic
903655175 1:24944496-24944518 ATGTTACCTTATATGGCAAAAGG + Intronic
903935124 1:26890118-26890140 AGGTCAACTCACAGGGAAAACGG + Exonic
904114517 1:28151745-28151767 CTGTGACCTCACATGGCAAAAGG - Intronic
904389766 1:30174637-30174659 ATGTTATCTTACGTGGCAAAAGG + Intergenic
904737044 1:32642631-32642653 ATGTTAACTAACATCTGAATAGG + Intronic
906646235 1:47477486-47477508 ATGTTACCTTACATGGTGAAAGG - Intergenic
906857787 1:49327193-49327215 ATGTTACCTTACATGGCAAAGGG - Intronic
907084301 1:51655548-51655570 ATGTTACATTACATGGCAAAAGG - Intronic
907115859 1:51967898-51967920 ATGTTACCTTACATGGCAAAAGG + Intronic
907619576 1:55962825-55962847 ATGTTACCTTATATGGCAAAAGG - Intergenic
908068045 1:60428978-60429000 ATGTTAAGTTATATGGCAAAAGG + Intergenic
908096806 1:60747794-60747816 ATGTTACCTTACATGGCAAAAGG - Intergenic
908124499 1:61016766-61016788 ATGTTACCTTACGTGGCAAAGGG - Intronic
908268093 1:62397809-62397831 ATGTTATCCCACATGGCAAAAGG + Intergenic
908592852 1:65652134-65652156 CTGTTCACTCCCATGGAAAAGGG + Intergenic
908894503 1:68883167-68883189 CTGTTAACTGAGATGGGGAATGG + Intergenic
908897980 1:68922817-68922839 ATGTTACCTTACATGGCAAAGGG + Intergenic
909026255 1:70485714-70485736 ATGTTATCTTACATGGTGAAAGG + Intergenic
909580617 1:77229502-77229524 ATGTTACCTTATATGGCAAAAGG + Intergenic
909602286 1:77473044-77473066 ATGTTACCTTACATGGCCAAAGG - Intronic
909780929 1:79546085-79546107 ATGTTATCTTACATGGCAAAAGG + Intergenic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
910093525 1:83493474-83493496 ATGTTATCTTACATGGAAAAGGG + Intergenic
910113062 1:83702382-83702404 AAGTTACCTTACATGGCAAAGGG - Intergenic
910113200 1:83703552-83703574 AAGTTACCTTACATGGCAAAGGG + Intergenic
910207821 1:84765359-84765381 ATGTTACCTTACATGACAAAAGG - Intergenic
910318668 1:85919067-85919089 ATGTTTAGTCTCATGGCAAAAGG - Intronic
910556703 1:88542476-88542498 ATATTACATCACATGGCAAAAGG + Intergenic
910616216 1:89201267-89201289 ATGTGTACTCACATGGTGAAGGG + Intergenic
911345595 1:96693036-96693058 ATGTTACCTTACATAGCAAAAGG + Intergenic
911716833 1:101142807-101142829 ATGTCATCTTACATGGCAAAAGG - Intergenic
911758428 1:101588127-101588149 ATGTTACCTTTCATGGCAAAAGG - Intergenic
912148906 1:106831877-106831899 ATGTTATTTTACATGGCAAAAGG - Intergenic
912254924 1:108048671-108048693 ATGTTATCTTACACGGCAAAAGG + Intergenic
912988953 1:114464680-114464702 ATATTAATTTACATGGTAAAAGG + Intronic
913266662 1:117051842-117051864 AGGTTAACTCAGAAAGGAAAAGG + Intergenic
913674854 1:121131032-121131054 ATGTTACCTTATATGGCAAAGGG - Intergenic
914026693 1:143918664-143918686 ATGTTACCTTATATGGCAAAGGG - Intergenic
914207328 1:145544256-145544278 TTGTTATCTTACATGGCAAAAGG + Intergenic
914334444 1:146701644-146701666 ATGTTACCTTATATGGCAAAAGG - Intergenic
914665075 1:149826099-149826121 ATGTTACCTTATATGGCAAAGGG - Intergenic
914670690 1:149867722-149867744 ATGTTACCTTATATGGCAAAGGG + Intronic
914931119 1:151934386-151934408 ACGTTACCACACATGGCAAAAGG - Intergenic
915217465 1:154349682-154349704 GTCTTAACTCTCCTGGGAAAAGG + Exonic
915974202 1:160374499-160374521 CATTTAACTCACATGGGAAGGGG - Intergenic
916034802 1:160912355-160912377 ATGTTATCTTAGATGGCAAAAGG - Intergenic
916189075 1:162161220-162161242 GTGTTACCTCACATGACAAAGGG - Intronic
916191685 1:162185260-162185282 ATGTTACTTTACATGGCAAAAGG - Intronic
916476820 1:165177498-165177520 ATGTTACATCATATGGCAAAAGG + Intergenic
916861460 1:168810314-168810336 AGGTTAAATCTCATGGGAACAGG - Intergenic
917268023 1:173242542-173242564 ATGTCACCTCACATGGTCAAGGG + Intergenic
917426149 1:174916476-174916498 ATGTCAACCCAGAGGGGAAAAGG + Intronic
918033530 1:180841947-180841969 TTGTTAAAGAACATGGGAAATGG + Intronic
918060090 1:181053515-181053537 AAGTTAACACAGAAGGGAAAGGG + Intronic
918191394 1:182178299-182178321 ATGTCACCTTACATGGCAAAAGG + Intergenic
918317405 1:183333356-183333378 ATGTTATCTTACATGGCAGAAGG + Intronic
918506409 1:185259303-185259325 ATGTTAACTCCTATGAGAGATGG - Intronic
918896621 1:190356723-190356745 ATGTTACCTTACATGGCAAGAGG - Intronic
919023084 1:192134223-192134245 ATGTTAAGTTACAAGGCAAAGGG + Intergenic
919182651 1:194104800-194104822 ATGCTCCCTCACATGGGGAAGGG - Intergenic
919327799 1:196131295-196131317 ATGTTACCTTCCATGGCAAAAGG + Intergenic
919569755 1:199232884-199232906 ATGTTAACTTATTTGGAAAAAGG - Intergenic
920535782 1:206735796-206735818 ATGTTCCCTTACATGGCAAAGGG - Intergenic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
921309770 1:213831215-213831237 GTGTCACCTCACATGGAAAAAGG + Intergenic
921329152 1:214018148-214018170 ATGTTATCTGCCATGTGAAAAGG - Intronic
921493430 1:215807044-215807066 ATGTTATGTTACATGGCAAAGGG + Intronic
921526269 1:216222467-216222489 ATGTTACCTTACTTGGTAAAAGG + Intronic
922871428 1:228905048-228905070 ATGTTATGTTACATGGCAAAGGG + Intergenic
923504744 1:234595595-234595617 ATATGAAGTCACATGGTAAAAGG + Intergenic
923785681 1:237066208-237066230 ATGTAAACAGACATGAGAAAAGG - Intronic
923788393 1:237090294-237090316 ATGTTACTTTACATGGCAAAAGG + Intronic
923991998 1:239448581-239448603 ATTTTATCTCATATGAGAAAAGG + Intronic
924327685 1:242912055-242912077 ATGTTATCTTACATGGCAAAGGG - Intergenic
924444512 1:244116751-244116773 ATGTTGCTTCACATGGAAAAAGG + Intergenic
924587761 1:245375009-245375031 GTGTTACCTTACATGGTAAAAGG + Intronic
924596213 1:245447181-245447203 ATGTTAATTCAGATGGGCCACGG - Intronic
924846116 1:247773974-247773996 ATATTACCTTACATGGTAAAAGG + Intergenic
1063740383 10:8811598-8811620 ATGTTACATTACATGGCAAAAGG - Intergenic
1063835341 10:10005707-10005729 ATGTGACCTCAAATGGTAAAAGG + Intergenic
1064018521 10:11791338-11791360 AGGTTGACTCACGTGGGCAAAGG - Intergenic
1064561120 10:16596218-16596240 ATGTTACCTTACATGACAAAAGG + Intronic
1064687134 10:17874502-17874524 ATGTTAGCTTACATGGAAAATGG - Intronic
1065037384 10:21653628-21653650 ATGTTATATTACATGGCAAAAGG - Intronic
1065659254 10:27988824-27988846 ATGTCACCTTACATGGCAAAAGG + Intronic
1065675051 10:28165188-28165210 ATGTTACCTCACATGGTAAAGGG + Intronic
1065747157 10:28853060-28853082 ACTTTAACTCATATGGGAAAGGG - Intronic
1065862990 10:29886998-29887020 ATGTGAGTTCACATGGAAAAGGG - Intergenic
1066011700 10:31200453-31200475 ATGTTACATTACATGGCAAAGGG + Intergenic
1066054572 10:31668493-31668515 CTGTTACCTCACATGGAAGAAGG + Intergenic
1066228189 10:33405028-33405050 ATGTCACCTTACATGGTAAAAGG - Intergenic
1066444338 10:35468186-35468208 GTGTAACCTCACATGGCAAAAGG + Intronic
1067541416 10:47157261-47157283 ATGTGAACTCACATGGCCCAGGG - Intergenic
1067698740 10:48553688-48553710 ATGTTACCTTATATGGCAAAGGG + Intronic
1067825584 10:49570287-49570309 ATGTTAAATTATATGGCAAAGGG - Intergenic
1067995870 10:51272656-51272678 ATGTTCACCCAGCTGGGAAAAGG - Intronic
1068391404 10:56401927-56401949 ATGTTTCCTTACATGGCAAAAGG + Intergenic
1068415790 10:56720462-56720484 ATGTTACCTTATATGGCAAAAGG - Intergenic
1068833429 10:61523980-61524002 ATATTACCTTACATGGCAAAAGG + Intergenic
1068839431 10:61593462-61593484 ATGTCATCTCACATGGCAAAAGG + Intergenic
1068988681 10:63129884-63129906 ATGTTACCTCATATGGCAAAGGG + Intergenic
1069132098 10:64718493-64718515 ATGTTAGCTTACAGGGTAAAGGG - Intergenic
1069321442 10:67176618-67176640 ATGTTACCTGACATGGCAAGAGG + Intronic
1069808181 10:71138924-71138946 GTGTTACTTCACATGGCAAAAGG + Intergenic
1070039633 10:72763213-72763235 ATGTTACCTTACGTGGCAAAAGG - Intronic
1070342888 10:75513858-75513880 ATGTGACCTTACATGGCAAATGG - Intronic
1070362009 10:75699746-75699768 ATGTTACCTTATATGGAAAAAGG + Intronic
1070525941 10:77296085-77296107 ATGTGACCTTACATGGCAAAAGG + Intronic
1070629426 10:78074366-78074388 ATGTTAACTTACGTGGCAAAAGG + Intergenic
1070633277 10:78103821-78103843 ATGTTACCCTACATGGCAAAAGG + Intergenic
1070686646 10:78489713-78489735 ATGTTATCTTACATGGCAAAGGG - Intergenic
1070822104 10:79363670-79363692 GTGTTAACTTACATAGCAAAAGG - Intergenic
1070990663 10:80729478-80729500 ATGTTACCTTACAGGGTAAAAGG + Intergenic
1071185410 10:83038145-83038167 CTGTTCACTCAAATGAGAAAAGG - Intergenic
1071370738 10:84949006-84949028 ATGTTACCTTACATGCAAAAGGG - Intergenic
1071776033 10:88789122-88789144 ATGTTACCTTATATGGCAAAAGG + Intergenic
1072000667 10:91192896-91192918 AGGTTAAATTACATGGCAAAAGG + Intronic
1072031626 10:91527275-91527297 ATGTTACCTTACATGGCAAGTGG - Intergenic
1072863581 10:99033007-99033029 ATGTTAACTTACATGGCAAAGGG - Intronic
1072979328 10:100086688-100086710 ATGTTATGTTACATGGCAAAGGG + Intergenic
1073814664 10:107193476-107193498 ATATTACCCTACATGGGAAAAGG + Intergenic
1074153190 10:110776727-110776749 ATGTTATCTTACATGGTAAAGGG - Intronic
1074249996 10:111735522-111735544 ATGTTACCTTACATGGCAAAGGG - Intergenic
1074425086 10:113343564-113343586 ATGTTACCTTATATGGTAAAAGG + Intergenic
1074494066 10:113963639-113963661 ATGTTACCTCACATGGCAAAAGG - Intergenic
1074670731 10:115787748-115787770 ATGTTACCTTACTTGGTAAAAGG + Intronic
1074771328 10:116736467-116736489 ATGTTATCTCCTATGGGAAAAGG + Intronic
1074851834 10:117445307-117445329 ATATTACCTTACATGGCAAAGGG - Intergenic
1075029089 10:119009131-119009153 ACGTTACCTTACATGGTAAAGGG + Intergenic
1075245459 10:120818309-120818331 ATGTTACCTTACATGGCAAAGGG + Intergenic
1075667792 10:124243438-124243460 ATGTTCCCTTACATGGCAAAAGG + Intergenic
1075699463 10:124459825-124459847 ATATTACCTGACATGGCAAAAGG - Intergenic
1075903395 10:126061481-126061503 ATGTTATCTGACATGGCAAAAGG + Intronic
1075930369 10:126289938-126289960 ATGTTACCTTACTTGGCAAAAGG + Intronic
1076152480 10:128173754-128173776 ATGCTACCTTACATAGGAAAAGG + Intergenic
1076926867 10:133495179-133495201 ATGTTAACTCACAAGACAATGGG - Intergenic
1078206372 11:9233511-9233533 ATGTTATCTTACTTGGAAAAAGG + Intronic
1078267927 11:9768851-9768873 ATGTCATCTTACATGGCAAAGGG - Intergenic
1078360165 11:10661807-10661829 ATGTTACCTTAAATGGCAAAAGG - Intronic
1078388605 11:10915258-10915280 ATGTTACCTTACATGGTAAAAGG - Intergenic
1078415349 11:11160384-11160406 ATGTTACCTTATATGGCAAAAGG - Intergenic
1078453882 11:11460184-11460206 ATGTTACCTTACATGGCAAAAGG - Intronic
1078578604 11:12521605-12521627 GTGTTATCTTACATGGCAAAAGG + Intronic
1078882534 11:15466330-15466352 ATGTTACCTAATGTGGGAAAAGG - Intergenic
1078943275 11:16033307-16033329 ATGTTTACTCACTTGGGAGGTGG - Intronic
1079022125 11:16917705-16917727 ATGTTACCTTATATGGGAAAAGG - Intronic
1079986554 11:27206261-27206283 ATGTTATCTTACATGGCAAAAGG + Intergenic
1080109076 11:28545322-28545344 TTGTTACCTTACATGGCAAAAGG + Intergenic
1080214008 11:29820397-29820419 GTGTTAACTCACTTGGCAATGGG + Intergenic
1080490471 11:32757891-32757913 ATGTTACCTTATATGGCAAAAGG - Intronic
1080708803 11:34725595-34725617 ATGTTACCTTACATGGCAAAAGG + Intergenic
1080928947 11:36787354-36787376 ATGTCTCCTCACATGGCAAAAGG - Intergenic
1081104862 11:39053778-39053800 ATGTTAACTTACATTGACAAGGG - Intergenic
1081340902 11:41926317-41926339 ACGTTACCTTACATGGCAAAGGG + Intergenic
1081362190 11:42193692-42193714 ATGTTACCTTACATGGCATAAGG - Intergenic
1081375362 11:42351972-42351994 ATGTGACCTTACATGGTAAAAGG + Intergenic
1081597994 11:44472519-44472541 ATGTTACCTTATATGGCAAAGGG + Intergenic
1081601263 11:44496507-44496529 ATGTTGCCTTACATGGCAAAAGG - Intergenic
1081844825 11:46232775-46232797 ATGCTATGTTACATGGGAAAGGG + Intergenic
1082243858 11:49897677-49897699 ATGTAAATTCACATGGCATAAGG - Intergenic
1084724182 11:70929746-70929768 ATGTTACTTTACATGGCAAAAGG - Intronic
1085196431 11:74674901-74674923 ATGTTAGGTCACATGGTAAAGGG - Intergenic
1085331768 11:75657936-75657958 ATGTTATCTTACATGGCAAAGGG - Intronic
1085622580 11:78048604-78048626 ATGTTAGGTTACATGGCAAAGGG + Intronic
1085772940 11:79340887-79340909 ATGTTACCTTACATGGTAAAAGG + Intronic
1085950003 11:81319014-81319036 CTCTTTACTCACATAGGAAATGG - Intergenic
1086051828 11:82601270-82601292 CTGTGACCTCACATGGGAAGGGG + Intergenic
1086055207 11:82638686-82638708 ATGTTATGTTACATGGTAAAGGG - Intergenic
1086121082 11:83304976-83304998 ATGTTACCTTACATGGTAAAAGG + Intergenic
1086538835 11:87883566-87883588 ATGTTGCCTTACATGGCAAAGGG + Intergenic
1086585912 11:88450743-88450765 ATGTTCCCTTACATGAGAAAAGG + Intergenic
1086594460 11:88554376-88554398 ATGTTATCTTACATGGCAAAAGG - Intronic
1086939380 11:92779689-92779711 ATGTTATGTTACATGGCAAATGG + Intronic
1087662400 11:101002733-101002755 ATATTACCTTACATGGCAAAAGG - Intergenic
1087710085 11:101538534-101538556 ATGTTACGTTACATGGCAAAAGG + Intronic
1087984237 11:104657791-104657813 TTGTTAGTTCACATGGCAAAAGG - Intergenic
1088124352 11:106405437-106405459 ATGTTACATTACATGGCAAAGGG - Intergenic
1088717054 11:112558041-112558063 ATGTTACCTCATATGGCAGAAGG + Intergenic
1088962633 11:114684749-114684771 ATTTTAATTCATATGGAAAAAGG + Intronic
1088963484 11:114694256-114694278 ATGTTAAGTTACATGGCAAAAGG - Intronic
1089154888 11:116394098-116394120 ATGTTACCTTACATGGCAACAGG + Intergenic
1089355253 11:117846255-117846277 ATGTCAACTCACTTGGAAAACGG - Intronic
1089838357 11:121391901-121391923 ATGTTACTTTACATGGAAAAGGG - Intergenic
1090320465 11:125838752-125838774 ATGTTACCTTACATGGCAAAAGG + Exonic
1090596743 11:128328892-128328914 ATGATAACTCACTTGGAGAAAGG - Intergenic
1091946914 12:4554401-4554423 ATGTTACCTTACATGGCAAAGGG - Intronic
1091979600 12:4854363-4854385 TAGTTAGCTCACCTGGGAAATGG + Intergenic
1092134915 12:6140248-6140270 ATGCTACCTTACATGGCAAAAGG + Intergenic
1092398064 12:8146105-8146127 CTGTCTACTCCCATGGGAAAGGG + Intronic
1092671370 12:10865642-10865664 ATGTTAAATTACATGGCGAAGGG - Intronic
1092673383 12:10888275-10888297 ATATTAACTTACATGACAAAGGG - Intronic
1092702394 12:11246739-11246761 ATGTTAACTTACATGACAAAAGG + Intergenic
1092711972 12:11348447-11348469 ATGTTAACTTACATGACAAAGGG + Intergenic
1092870203 12:12799631-12799653 ATGTTATCTTACATGGCAATGGG - Intronic
1092928965 12:13297268-13297290 ATGTTACCTTACATGGCCAAAGG - Intergenic
1093404902 12:18792383-18792405 CTGTTACCTTACATGGCAAAAGG - Intergenic
1093636310 12:21473947-21473969 ATGTTACCTCACATGGCAAAAGG - Intronic
1093684255 12:22038451-22038473 GTGTTACCTTACATGGTAAAAGG - Intergenic
1093751284 12:22803365-22803387 ATGTTACTTTACATGGCAAAAGG - Intergenic
1094075322 12:26465891-26465913 ATGTAAGCTCACAGAGGAAAGGG + Intronic
1094081820 12:26545211-26545233 ATGTTACCTCACATGCCAAAAGG + Intronic
1094383463 12:29868522-29868544 ATTTTACCTCACATGGCAAAGGG - Intergenic
1094585352 12:31772633-31772655 ATGTTAACTTACATGGCAAGAGG - Intergenic
1094687561 12:32733270-32733292 ATGTTAACTTATTTGGGTAAAGG - Intronic
1095622771 12:44278176-44278198 GTGTTACCTTACATGGCAAAGGG - Intronic
1095626686 12:44322872-44322894 ATGTTAAGTTGCATGGCAAAGGG + Intronic
1095672738 12:44878913-44878935 ATGTTACCTCACATGGCAAAGGG + Intronic
1095735142 12:45548059-45548081 ATGTTTACTTACATGGCAAATGG + Intergenic
1096204727 12:49711539-49711561 ATGTTATCTTACATGGCAAAAGG + Intronic
1096498026 12:52050022-52050044 ATATTGACTTACATGGGAGAAGG + Intronic
1096851027 12:54437537-54437559 ATGGAAACTCACCTGGGCAAAGG + Intergenic
1097444722 12:59656262-59656284 ATGTTATGTTACATGGTAAAGGG + Intronic
1097610549 12:61814637-61814659 ATGTTACCTCACATGCCAAAAGG + Intronic
1097785906 12:63758624-63758646 ATATTATCTTACATGGCAAAGGG - Intergenic
1098084733 12:66830244-66830266 ATGTTACCTTACATGGTAAAAGG + Intergenic
1098205573 12:68105831-68105853 ATGCTACCTTACATGGAAAAAGG + Intergenic
1098516811 12:71386935-71386957 ATGTTATATTACATGGCAAAAGG + Intronic
1098958586 12:76714273-76714295 ATATTATCTCACATAGCAAAAGG - Intergenic
1099714624 12:86275507-86275529 ATGTTACCTTACTTGGCAAAAGG + Intronic
1099904086 12:88751278-88751300 ATGTTACCTTACATGGCAAAAGG - Intergenic
1099927482 12:89035299-89035321 ATGCTATCTCAGATGGCAAAGGG + Intergenic
1100159005 12:91835605-91835627 ATGTTACCTTACATGGAAACAGG - Intergenic
1100180774 12:92083781-92083803 ATGTTGCCTTACATGGCAAATGG - Intronic
1100431330 12:94534188-94534210 ATGTGACCTTGCATGGGAAAAGG + Intergenic
1100580174 12:95931405-95931427 ACGTTACCTTACATGGCAAAAGG - Intronic
1100822458 12:98444189-98444211 ATGTTACCTTACCTGGCAAAAGG - Intergenic
1100930153 12:99599184-99599206 ATGTTACCTTACTTGGAAAAAGG - Intronic
1101062184 12:100983838-100983860 ATGTTATGTTACATGGCAAAAGG - Intronic
1101182505 12:102234716-102234738 ATTATAAATTACATGGGAAAGGG - Intergenic
1101191258 12:102335858-102335880 ATATTACCTTACATGGCAAAAGG - Intergenic
1101191283 12:102336044-102336066 ATGTTATCTTACTTGGAAAACGG + Intergenic
1101300205 12:103471934-103471956 ATTTTAAGTCAAATGGGAAAAGG - Intronic
1101468090 12:104968446-104968468 AACTTTAATCACATGGGAAAGGG - Intergenic
1101522359 12:105495634-105495656 GTGTAAAGTCACATGGCAAAGGG + Intergenic
1102386776 12:112516665-112516687 ATGTTACTTTACATGGCAAAAGG - Intergenic
1102591931 12:113962854-113962876 ATGTTACCTTACAAGGCAAAAGG + Intronic
1102748136 12:115268025-115268047 ATGAGAACTGGCATGGGAAAAGG - Intergenic
1103024902 12:117565629-117565651 AGTTTATCTCACATGGTAAAGGG - Intronic
1103137830 12:118523057-118523079 ATGTTACCTTTCATGGCAAAAGG + Intergenic
1103284020 12:119785245-119785267 ATATTACCACACATGGCAAAAGG + Intronic
1103799312 12:123526993-123527015 ATGTTACCTTACATGGCAAAAGG + Intronic
1103895288 12:124269164-124269186 ATGTTACCTTCCATGGCAAAGGG + Intronic
1103981582 12:124740253-124740275 ATGTTAGCTGACATGGCAAAAGG - Intergenic
1104063505 12:125287327-125287349 ATGTTACCTTACATGGTAAAAGG - Intronic
1104111642 12:125710191-125710213 ATGTGACCTTACATGGCAAAAGG + Intergenic
1104263991 12:127213250-127213272 ACGTTACCTTACATGGTAAAAGG - Intergenic
1104289082 12:127452094-127452116 ATGTTAACCAGCATGGCAAAGGG - Intergenic
1104291179 12:127470210-127470232 ATGTCCACTCACATTGGAGAGGG + Intergenic
1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG + Intergenic
1104368290 12:128198021-128198043 ATGTTATCTAACATAGTAAAAGG + Intergenic
1104409549 12:128546839-128546861 ATGTTACCTTACAAGGCAAAGGG - Intronic
1104425000 12:128668966-128668988 ATGTTACCTTACATGGTAAAAGG - Intronic
1104597016 12:130126828-130126850 ATGTCACCTTACATGGTAAAAGG + Intergenic
1105660744 13:22491747-22491769 ATTTTAACTTACATGGTGAAAGG + Intergenic
1105660951 13:22494584-22494606 ATTTTAACTTACATGGTGAAAGG + Intergenic
1106139856 13:27003085-27003107 ATGTCACCTTACATGGCAAAGGG + Intergenic
1106724893 13:32473897-32473919 ATCTTATCTTACATGGCAAAGGG - Intronic
1106735351 13:32583510-32583532 ATGTTATGTTACATGGCAAAGGG + Intergenic
1107366273 13:39680943-39680965 ATGTTACCTTACATGGCAAAAGG - Intronic
1107639958 13:42431826-42431848 ATGTTACCTTACATTGCAAAAGG + Intergenic
1107691802 13:42960965-42960987 ATGTTTCCTTACATGGGTAAGGG - Intronic
1108033050 13:46256929-46256951 ATGTTATATTACATGGCAAAGGG + Intronic
1108036612 13:46296784-46296806 ATGTTATGTCACATGGCAATGGG - Intergenic
1108436625 13:50407023-50407045 ATGTCAACTCCCAGGGGACAAGG - Intronic
1108477046 13:50830757-50830779 ATGTTACCCCACATGGCACAGGG + Intronic
1108510453 13:51151164-51151186 ATGTTACACCACATGGTAAAGGG + Intergenic
1108697372 13:52914247-52914269 ATATTACCTTACATGGCAAAAGG + Intergenic
1109243034 13:59914491-59914513 ATATTAAGTTACATGGCAAAGGG + Intronic
1110005474 13:70261164-70261186 ATGATTATTCACATGGAAAATGG - Intergenic
1110131591 13:72018202-72018224 ATGCTACCTTACATGGAAAAAGG + Intergenic
1110471718 13:75867015-75867037 ATGTTACATCATATGGCAAAGGG - Intergenic
1110574475 13:77039979-77040001 ATGTTGCCTTACATGGCAAATGG - Intergenic
1110593607 13:77293548-77293570 ATATTACCTTACATGGCAAAAGG + Intronic
1110614552 13:77526932-77526954 ATGTTATCTTACATGTTAAAAGG + Intergenic
1110997200 13:82126217-82126239 ATGTTATCTTACATGACAAAAGG + Intergenic
1111005883 13:82248246-82248268 ATGTTAACTCACATGACACAAGG - Intergenic
1111306905 13:86426477-86426499 ATGTTACCTTACATGGAAAAAGG + Intergenic
1111729561 13:92056405-92056427 ATGTTACCTCACATGGCAAAAGG - Intronic
1112143600 13:96673310-96673332 ATGTTATCTTAATTGGGAAAAGG - Intronic
1112191787 13:97185429-97185451 ATGTTACCTTACATGGAAAAAGG + Intergenic
1112569684 13:100582443-100582465 ATGTTAACTCCTATGCCAAAAGG + Intronic
1112669592 13:101619260-101619282 ATGTTAGATTACATGGCAAAAGG + Intronic
1112715587 13:102181284-102181306 ATGTTACCTGACATGGTAAAAGG + Intronic
1112805341 13:103158762-103158784 AGGTTATCTAAGATGGGAAAGGG + Intergenic
1112842100 13:103593053-103593075 ATGTGAGCTTGCATGGGAAAAGG + Intergenic
1113501189 13:110775719-110775741 CTGTGACCTCACATGGCAAAAGG - Intergenic
1114662586 14:24357220-24357242 ATGTTATCTTACATGGCAAAAGG - Intergenic
1114896039 14:26992517-26992539 ATGCCCACTCACATTGGAAAGGG + Intergenic
1115086815 14:29525477-29525499 ATCTTAACTCACATGATATAAGG - Intergenic
1115495687 14:34002203-34002225 ATGTTAGGTTACATGGCAAAGGG + Intronic
1115570050 14:34657868-34657890 ATGTTACCTTACATGGCAAAAGG + Intergenic
1115901099 14:38149036-38149058 ATGTTACCTTACATGGCAAAAGG + Intergenic
1116179182 14:41514158-41514180 ATGTTATCTTACATGGCAAAAGG + Intergenic
1116221386 14:42092603-42092625 ATGTTGCCTTACATGGCAAAAGG - Intergenic
1116715518 14:48420650-48420672 ATGTTATATTACATGGCAAAGGG - Intergenic
1116778672 14:49211829-49211851 ATGTTACCTTACATGGCAAAAGG - Intergenic
1117291774 14:54341527-54341549 ATATTACCTTACATGGCAAAAGG + Intergenic
1117484872 14:56185970-56185992 ATATTACCTTACATGGCAAAAGG + Intronic
1117748333 14:58894246-58894268 ATGTTACCTAACATGACAAAAGG + Intergenic
1117750502 14:58917707-58917729 ATGTGATCTCACATGGGAATTGG + Intergenic
1117863164 14:60114437-60114459 ATGTTAATTCAAATGTGCAAAGG - Intronic
1117873557 14:60225722-60225744 ATGTTACCTTATATGGCAAAAGG - Intergenic
1118009253 14:61592587-61592609 ATGTTACCTTACATGGCAAAAGG - Intronic
1118236295 14:64008303-64008325 ATGTTACCTCACAAGGCAAAAGG - Intronic
1118451144 14:65903545-65903567 ATGTTACCTTACATGGCAAAGGG + Intergenic
1119149288 14:72343510-72343532 ATGTGACTTCACATGGCAAAAGG - Intronic
1119158803 14:72435895-72435917 ATGATACCTTACATGGCAAAAGG - Intronic
1119201970 14:72760488-72760510 ATGTTACCTTACATGGCAAAAGG - Intronic
1119505670 14:75171030-75171052 GTGTTATCTTACATGGCAAAAGG + Intronic
1120063753 14:80015501-80015523 ATGTTACCTTATATGGCAAAAGG - Intergenic
1120090299 14:80324164-80324186 ATGTTACCTTACAAGGCAAAGGG + Intronic
1120125389 14:80735990-80736012 ATGTTACCTTACATGGCAAAAGG - Intronic
1120720475 14:87885063-87885085 ATGTTGCCTCAAATGGCAAAAGG + Intronic
1120741368 14:88112177-88112199 ATGTTACATTACATGGTAAAGGG - Intergenic
1120758400 14:88265213-88265235 ATGTTATCTTACATGGCAAAAGG + Intronic
1121660431 14:95631298-95631320 ATATTAGCTCGCATGGCAAAGGG + Intergenic
1121846821 14:97179515-97179537 ATGTTACCTTAGATGGCAAAGGG - Intergenic
1121908516 14:97768638-97768660 ATGTTCATTTACATGGCAAAGGG + Intergenic
1122373153 14:101240434-101240456 ATGTCACCTTACATGGCAAAAGG + Intergenic
1123463288 15:20494092-20494114 AAGTTAAATCAAATGTGAAAGGG + Intergenic
1123628482 15:22244359-22244381 ATGTGACCTCACATGGTAAAAGG + Intergenic
1123654771 15:22506319-22506341 AAGTTAAATCAAATGTGAAAGGG - Intergenic
1124274132 15:28311499-28311521 AAGTTAAATCAAATGTGAAAGGG + Intronic
1124308684 15:28601521-28601543 AAGTTAAATCAAATGTGAAAGGG - Intergenic
1124422621 15:29536045-29536067 ACCTTGAGTCACATGGGAAAAGG - Intronic
1124642788 15:31407001-31407023 ATGTTATCTCACATGGAAAAAGG - Intronic
1125453451 15:39833025-39833047 ATGTTAAGTCTCATGGTAAATGG - Intronic
1126260809 15:46688490-46688512 ATGTTACCTTTCATGGCAAAAGG - Intergenic
1126405272 15:48316636-48316658 ATTTTACCTTACATGGAAAAAGG + Intergenic
1126532059 15:49721474-49721496 ATGTTACCCTACATGGAAAAGGG + Intergenic
1126589014 15:50320608-50320630 ATGCTACCTTACATGGCAAAAGG + Intronic
1126974748 15:54163077-54163099 ATGTTACCTTACGTGGCAAAAGG + Intronic
1127212986 15:56794195-56794217 ATTTTAATGCACATGTGAAATGG - Intronic
1127230936 15:56993889-56993911 ATTTCAACTCACATGAGAAGAGG + Intronic
1127392224 15:58515225-58515247 ATGTTACCTTATATGGAAAAGGG - Intronic
1127686753 15:61353304-61353326 ATGTGTTCTCACATGGCAAAGGG - Intergenic
1127796537 15:62443132-62443154 ATGGTATCTTACATGGCAAAAGG - Intronic
1128625755 15:69201217-69201239 AAGTTACCTTACATGGCAAAAGG - Intronic
1128692679 15:69737184-69737206 ATGTTACCTTACATGGCAAGAGG + Intergenic
1129062112 15:72868459-72868481 ATGTTATGTTACATGGCAAAAGG - Intergenic
1129128548 15:73468115-73468137 ATGTTATCTTACATAGCAAAGGG - Intronic
1130008880 15:80131381-80131403 ATATTAACTCTCAAGGGAACAGG - Intronic
1130175843 15:81569815-81569837 ATCTTAACTCAGATGCGGAAGGG + Intergenic
1130183982 15:81661371-81661393 TTGTTTAGTCACTTGGGAAAAGG + Intergenic
1130426972 15:83811160-83811182 ATGTTATCTTACATGGCAAAAGG - Intronic
1131297841 15:91167699-91167721 ATGTTACCTTGCATGGTAAAAGG - Intronic
1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG + Intronic
1131997457 15:98145976-98145998 ACGTTACCTTACATGGCAAAAGG + Intergenic
1132106810 15:99068775-99068797 CTGTTTCCTCACATGTGAAATGG + Intergenic
1132155044 15:99489695-99489717 ATGTTACCCCACATGGCAAAAGG - Intergenic
1132248006 15:100312126-100312148 ATGTGAACTTACATGGTAAACGG + Intronic
1133481282 16:6173155-6173177 ATGTTACCGTACATGGCAAAGGG - Intronic
1133689401 16:8198849-8198871 ATGTTACCTCACATCGGAGGTGG + Intergenic
1133782772 16:8952666-8952688 ATGTTACGTTACATGGCAAAGGG - Intronic
1133864697 16:9631818-9631840 AACTTAGCTCACAGGGGAAAGGG - Intergenic
1133904093 16:10004831-10004853 ATGTTACCTTACATGACAAAAGG - Intronic
1133904825 16:10012598-10012620 ATGTTACCTTACATGGCAAAAGG + Intronic
1134284229 16:12846227-12846249 ATGTTATGACACATGGCAAAGGG - Intergenic
1134362803 16:13547623-13547645 ATGCTAACTCACATTGATAAGGG + Intergenic
1134371827 16:13633124-13633146 ATGTTACCTCACTTGGCAAAAGG + Intergenic
1134742206 16:16557929-16557951 ATGTTAAGTGACATGGCAAAGGG + Intergenic
1134925356 16:18154527-18154549 ATGTTAAGTGACATGGCAAAGGG - Intergenic
1135408263 16:22213936-22213958 ATGTTACCTTATATGGCAAAAGG - Intronic
1136137729 16:28267487-28267509 ATGTTACCTTCCATGGCAAAAGG - Intergenic
1136231516 16:28888340-28888362 ATGTTACCTTACTTGGAAAAGGG - Intronic
1136292061 16:29280315-29280337 ATGGCAACTCACTTGGAAAAGGG - Intergenic
1137391453 16:48084737-48084759 ATATTAACTTACCTGGCAAAAGG - Intronic
1137733822 16:50709727-50709749 ATGTTACCTTACGTGGCAAAAGG - Intronic
1137882286 16:52062584-52062606 ATGTTATCTTACATGGCAAAGGG - Intronic
1137886950 16:52115375-52115397 ATGTTAATTTATATGGCAAAAGG - Intergenic
1138210425 16:55158511-55158533 ATGTTACCTCACATGGCAAAGGG - Intergenic
1138778885 16:59758458-59758480 ATGTTACCACACATGATAAAAGG - Intergenic
1138843980 16:60542783-60542805 ATGTTATGTTACATGGCAAAGGG + Intergenic
1138888730 16:61114697-61114719 ATGTTAATTTATATGGCAAAGGG + Intergenic
1139353475 16:66352748-66352770 ATGTTATGCCACATGGCAAATGG - Intergenic
1140429268 16:74887800-74887822 ATGTGAACTGTCATGGGGAATGG - Intronic
1140503957 16:75458345-75458367 AGATTAACCCACATGGGAAAAGG + Intronic
1140565028 16:76031774-76031796 ATGTTAAATTACATGGCAAAGGG + Intergenic
1140632079 16:76865179-76865201 ATGTTACCTTACATGGCAAAAGG - Intergenic
1140642368 16:76991100-76991122 GTGTTACCTTACATGGCAAAAGG - Intergenic
1140700532 16:77577359-77577381 GTGTTACCTTACATGGAAAAAGG - Intergenic
1140708728 16:77656547-77656569 ATGTTATCTTACATGGCAAAGGG - Intergenic
1140713198 16:77697141-77697163 ATGTTTAATTACATGGCAAAGGG + Intergenic
1140735613 16:77895359-77895381 ATGTTACCTCATATGGCAAAAGG + Intronic
1140743923 16:77964598-77964620 TTGTTACCTGACATGGCAAAGGG - Intronic
1141066159 16:80915754-80915776 GTGTTACCTTACATGGTAAAAGG - Intergenic
1141083392 16:81073536-81073558 ATGTTATATTACATGGTAAAAGG + Intronic
1141222062 16:82080263-82080285 CTGTTACCTCACGTGGCAAATGG + Intronic
1141244607 16:82294220-82294242 ATGTTACCTTACATGGCAAATGG + Intergenic
1141304385 16:82847630-82847652 ATGTTAGATTACATGGCAAAGGG - Intronic
1141372672 16:83502154-83502176 ATGTTACCTTACAGGGCAAATGG + Intronic
1141444111 16:84047202-84047224 ATGTTACCCCACATGGCAAAAGG + Intergenic
1141588530 16:85051404-85051426 ATGTTATCTCAGAAGAGAAATGG + Intronic
1141739280 16:85879986-85880008 ATGATAAGTTACATGGCAAAAGG - Intergenic
1141763634 16:86044853-86044875 ATGTCACCTCACTGGGGAAACGG + Intergenic
1142097951 16:88254268-88254290 ATGGCAACTCACTTGGAAAAGGG - Intergenic
1142543620 17:681809-681831 ATGTGTCCTCACATGGGGAAAGG + Intronic
1143545019 17:7590563-7590585 AAGTTTTCTCACTTGGGAAAGGG - Intronic
1143674400 17:8421303-8421325 ATGTTACCTTATATGGCAAAAGG + Intronic
1143812483 17:9483460-9483482 ATGTTACCTTAAATGGCAAAAGG - Intronic
1143814009 17:9496621-9496643 ATGTTCCCTTACATGGCAAAAGG + Intronic
1143891638 17:10106827-10106849 ATGTTACCTTATATGGCAAAAGG + Intronic
1144824086 17:18095784-18095806 ATGTTAACTGCCAGGGAAAATGG - Intronic
1145222709 17:21102599-21102621 ATGTTTTCTCACAGGGTAAAAGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148201415 17:45752434-45752456 AGGTTGACTAACATGGGAGAGGG + Intergenic
1149040644 17:52184470-52184492 AAGTTACCTTACATGGTAAAAGG + Intergenic
1149063322 17:52450355-52450377 ATGTTACTTTACATGGTAAAAGG - Intergenic
1149093275 17:52810108-52810130 ATCTTATTTCACTTGGGAAAGGG + Intergenic
1149116612 17:53104933-53104955 GTGTTACCTTACATGGCAAAAGG + Intergenic
1149181829 17:53948814-53948836 ATGTTAATTAACAGGGGAACTGG - Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1150097607 17:62391530-62391552 ATGCTATCTTACATGGCAAAAGG - Intronic
1150170891 17:62993189-62993211 ATGTTACCTTACATGGCAAAGGG - Intergenic
1150522091 17:65879096-65879118 ATGTTACCTTATATGTGAAAAGG + Intronic
1150726132 17:67652888-67652910 ATGTGAACTTACTTGGGATAGGG + Intronic
1150836503 17:68568842-68568864 ATGTTACCTTATATGGAAAAAGG - Intronic
1150847463 17:68674315-68674337 ATGAGAATTCACATTGGAAAGGG + Intergenic
1152172558 17:78762572-78762594 ATGTTAAATTCCATGGCAAAAGG + Intronic
1152211812 17:79006422-79006444 ATGTTACATTACATGGCAAAGGG - Intronic
1152373532 17:79905586-79905608 ATGTCACCTTACATGGCAAAGGG - Intergenic
1152607449 17:81299875-81299897 ATGTGACCTCACTTGGCAAAAGG - Intergenic
1153066761 18:1054036-1054058 ATATTACCTTACATGGCAAAAGG - Intergenic
1153711433 18:7803496-7803518 ATGTTAAATTACATGGAAAGAGG - Intronic
1154088078 18:11326956-11326978 ATGTTACCTTACATGGCACAGGG + Intergenic
1154151638 18:11910743-11910765 AAGTTACCTGACATGGCAAAAGG + Intergenic
1155309255 18:24508362-24508384 AAGTAAGCTCACATGGGAGAAGG - Intergenic
1155913886 18:31536957-31536979 ATGTCCACTGACATGGGGAAGGG - Intronic
1156356485 18:36346457-36346479 ATGTTAATGCAAATGGTAAATGG + Intronic
1156757975 18:40551616-40551638 ATGTTACATTACATGGCAAAGGG - Intergenic
1156890613 18:42185940-42185962 ATGTCAAATCACATGGGAAATGG + Intergenic
1156986048 18:43352792-43352814 AGGTTAGCACATATGGGAAATGG - Intergenic
1157211181 18:45743300-45743322 ATGTGACCTCACATGGCAAAAGG - Intronic
1157434820 18:47659514-47659536 ATGTTACCTTATATGGCAAAAGG + Intergenic
1157659685 18:49429303-49429325 ATGTTACATTACATGGCAAAGGG - Intronic
1157900785 18:51514702-51514724 ATGTTAAGTTACATGGCAAAAGG + Intergenic
1158024001 18:52874404-52874426 ATGGTAACTAACATTGGCAATGG - Intronic
1158259711 18:55592970-55592992 AGGTTAGCTCACCTGGGGAAGGG - Intronic
1158590467 18:58774673-58774695 ATGTTACCTTATATGGCAAAAGG + Intergenic
1158839435 18:61368218-61368240 ATGTTATGTCATATGGCAAAGGG - Intronic
1158868252 18:61658948-61658970 ATATTACCTTACATGGAAAAAGG + Intergenic
1158968180 18:62642114-62642136 ATGTTACCTTACATGGCAAAAGG + Intergenic
1159275167 18:66209916-66209938 ATATTATCTTACATGGTAAATGG - Intergenic
1159625008 18:70682414-70682436 ATGTTACCATACATGGCAAAAGG + Intergenic
1159655002 18:71022710-71022732 ATGTTAACTTACATGGATAGGGG - Intergenic
1159671242 18:71223314-71223336 ATGTTAGATCACATGAGAAAAGG - Intergenic
1159674380 18:71263372-71263394 ATGTTAGCCTACATGGGAAAGGG + Intergenic
1159796292 18:72848170-72848192 ATGTTATGTTACATGGCAAAAGG - Intronic
1159896669 18:74003072-74003094 ATGTGAACAGACATGGGAGAAGG + Intergenic
1160139428 18:76307812-76307834 GTGTTACCTTACATGGCAAAAGG - Intergenic
1164880527 19:31728946-31728968 ATGCTAGCCCACATGGGCAAGGG - Intergenic
1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG + Intergenic
1166275000 19:41747349-41747371 AGGTGACCCCACATGGGAAACGG - Intronic
1167215131 19:48159512-48159534 ATGTTAGGTTACATGGCAAAGGG + Intronic
1167514504 19:49915219-49915241 ATGTGACCTTACATGGCAAAGGG + Intronic
1167847743 19:52178325-52178347 ATGTTTAATCACATGGGTACAGG - Intergenic
1167857456 19:52254179-52254201 ATGTTATGTTACATGGTAAAAGG + Intergenic
1167956349 19:53067677-53067699 TTTTTAACTCACATACGAAAAGG - Exonic
1168012068 19:53541013-53541035 ATATTACCTTACATGGCAAAGGG - Intronic
1168345227 19:55647566-55647588 CTGTTAACTCACCTGCAAAATGG - Intronic
1168360226 19:55733491-55733513 ATTTCAACTCATATGGGAGAAGG - Exonic
1168459279 19:56539706-56539728 ATGCCAACTCACCTGGGACATGG - Exonic
926360283 2:12080477-12080499 ATGTCACCTTACATGCGAAAGGG + Intergenic
926396445 2:12447386-12447408 ATGTGTCCTCACATGGCAAAAGG - Intergenic
926463074 2:13157773-13157795 ATGTTACATCACAAGGCAAAGGG - Intergenic
926574403 2:14564232-14564254 ATGTTATCTTACACGGCAAAGGG + Intergenic
926656109 2:15408121-15408143 ATGTTACCTTACCTGGCAAAAGG - Intronic
926888421 2:17618536-17618558 ATGTTACCTTACATGGCAAAAGG - Intronic
926935048 2:18078535-18078557 ATGTTACCTTACGTGGCAAAAGG - Intronic
926962798 2:18377120-18377142 TTGTTAGCCCACATGGCAAAAGG - Intergenic
927470591 2:23373091-23373113 ATGTTACCTTATATGGCAAAAGG + Intergenic
927710317 2:25321515-25321537 ATGTCACCTTACATGGCAAAAGG - Intronic
928340595 2:30439913-30439935 ATGTTACCTTACATGGCAAAAGG + Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
928650748 2:33401181-33401203 ATGTTACCTTCCATGGCAAAGGG + Intergenic
928777354 2:34781516-34781538 ATGTTACCTTACATGGCCAATGG + Intergenic
929010715 2:37441344-37441366 ATATTGAGTCACATGGAAAATGG + Intergenic
929055022 2:37869214-37869236 ACATTAACTCACATGGCAGAGGG - Intergenic
930035373 2:47082041-47082063 ATGTTACCTTACAGGGTAAAAGG + Intronic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
930673468 2:54175979-54176001 ATGTATCCTCACATGGTAAAGGG - Intronic
930873661 2:56190995-56191017 AAGTCAACGGACATGGGAAAGGG - Intronic
930936142 2:56954360-56954382 ATGTTATGTTACATGGCAAAAGG - Intergenic
930948328 2:57105091-57105113 ATGTTATATTACATGGCAAAGGG + Intergenic
931375588 2:61704886-61704908 ATGTTACCTTACATGGCAAAAGG - Intergenic
931451523 2:62370977-62370999 ATGTTACCTTACATGGCAAAGGG + Intergenic
931456829 2:62416514-62416536 ATGCTAGCTTACATGGCAAAAGG + Intergenic
931561777 2:63569651-63569673 TTGCTAACTCACGTGGGCAAGGG + Intronic
931708335 2:64966508-64966530 ATGTTAGCTCATATGACAAATGG - Intergenic
931940395 2:67245781-67245803 ATGTTCTCTCATATGGAAAAAGG + Intergenic
932281298 2:70494292-70494314 ATGCTACCTTACATGGCAAAGGG - Intronic
932283480 2:70514264-70514286 ATATTAACACACATGGAGAAAGG + Intronic
932376080 2:71237162-71237184 ATGTTAACTTACATGGTAAAAGG - Intergenic
933101157 2:78259464-78259486 ATGTTACCGTACATGGCAAAAGG - Intergenic
933172553 2:79139936-79139958 ATGTTATATTACATGGAAAAAGG - Intergenic
933338137 2:80986029-80986051 ATGCTATCTGACATGGCAAAAGG - Intergenic
933393382 2:81701202-81701224 ATGTTAACTTACGTGGCAAAAGG + Intergenic
933463867 2:82625144-82625166 ATGTTACCATACATGGAAAATGG + Intergenic
933717968 2:85376056-85376078 ATGTTATGTAACATGGCAAAGGG - Intronic
933979960 2:87541266-87541288 ATGTTACCTTACACGGCAAAAGG - Intergenic
934032885 2:88064369-88064391 ATGTTACCTTATATGGCAAAAGG - Intergenic
934103034 2:88671140-88671162 ATGTTACCTTATATGGCAAAGGG + Intergenic
934880484 2:97972633-97972655 ATGCCAAATCACATGGCAAAGGG + Intronic
934881290 2:97982662-97982684 ATGTTACCTTACATGGCAAAAGG + Intronic
934926596 2:98386222-98386244 AGGTTACCTCATATGGCAAAGGG + Intronic
934960885 2:98671701-98671723 ATGTTACCTTACATGGCAAAAGG + Intronic
935332765 2:101989134-101989156 ATGTTACCTTACATGGGAAAAGG + Intergenic
935355362 2:102194056-102194078 TTCTTAACTTTCATGGGAAAGGG - Intronic
935527277 2:104186335-104186357 ATGTCAATTCACATGAGAAAGGG - Intergenic
936313861 2:111409525-111409547 ATGTTACCTTACACGGCAAAAGG + Intergenic
936823439 2:116552467-116552489 ATGTTGCCTTACATGGCAAAAGG - Intergenic
937160287 2:119754670-119754692 ATGTTAGCTTGCATGGTAAAAGG + Intergenic
937242586 2:120471920-120471942 ATGTGACCTCACATGCCAAAAGG + Intergenic
937269999 2:120643615-120643637 ATGTCACCTTACATGGCAAAGGG - Intergenic
937330446 2:121024009-121024031 ATGTTACCTTATATGGCAAAAGG + Intergenic
937333837 2:121048375-121048397 ATGTTACCTTACATGTCAAAAGG + Intergenic
937363535 2:121245023-121245045 ATGTCACCTAACATGGCAAATGG + Intronic
937431509 2:121842595-121842617 ATGTTACTTTACATGGAAAAGGG + Intergenic
937588820 2:123589921-123589943 ATGTTAAGTCACATAGAAAATGG + Intergenic
937625258 2:124036292-124036314 TTATTAATTCACAAGGGAAAAGG + Intronic
938316049 2:130328793-130328815 ATTTTAAATCCCATGTGAAAGGG - Intergenic
938801793 2:134770640-134770662 ATGTTACCTTACATGGAAAAAGG - Intergenic
939229993 2:139412272-139412294 ATGTTACCTTACATGACAAAAGG + Intergenic
939509423 2:143088506-143088528 ATGTTACCTTACATGGCAAAAGG - Intergenic
939558255 2:143702943-143702965 ATGTTACCTCACATGGCAAAAGG - Intronic
939681570 2:145141478-145141500 ATGTTAACACACATGGTCAGAGG + Intergenic
939810251 2:146823177-146823199 ATGTTACCTTACATGGCAAACGG + Intergenic
939833736 2:147103128-147103150 ATGTTATATGACATGGCAAAAGG + Intergenic
940041095 2:149361789-149361811 ATGTTACCTTACATGGTAAAAGG + Intronic
940498726 2:154467194-154467216 ATATTAACTTACAAGGTAAAGGG + Intergenic
940804140 2:158166874-158166896 ATGTTATGTTACATGGCAAAGGG + Intergenic
941079710 2:161046296-161046318 ATGTTACGTGACATGGCAAAAGG + Intergenic
941114231 2:161452929-161452951 ATGTTATCTTACATGGTAAAAGG - Intronic
941291015 2:163675095-163675117 ATGTTAACTCAAATGTGGCATGG - Intronic
941356896 2:164504757-164504779 ATGTTAAGCTACATGGAAAAAGG + Intronic
941468454 2:165856972-165856994 GTGTTAACTTACATGGCAAAAGG + Intergenic
941512205 2:166425818-166425840 ATATTAACTTATATGGCAAAGGG - Intronic
941633454 2:167909373-167909395 ATGTTATTTTACATGGCAAAGGG - Intergenic
941722148 2:168823672-168823694 ATGTGACCTCATATGGGAATAGG - Intronic
941738614 2:169008539-169008561 ATGTTACCTTGTATGGGAAAAGG - Intronic
941957573 2:171220158-171220180 ATGTTATCTTATATGGAAAAAGG - Intronic
942493028 2:176508974-176508996 ATGTTACCTTACATGGCAAGAGG - Intergenic
942546649 2:177071590-177071612 ATGATACCGCACATGGCAAATGG + Intergenic
943003855 2:182364302-182364324 AAATTAACACACATGGGATAGGG - Intronic
943069384 2:183122885-183122907 ATGTTACCTTATATGGCAAAAGG + Intronic
943070452 2:183135172-183135194 ATGTTACATTACATGGCAAAGGG - Intronic
943179145 2:184521181-184521203 ATGTTAGGTTACATGGCAAAGGG + Intergenic
943197928 2:184779458-184779480 ATGTTAGGTTACATGGGAAAGGG + Intronic
943918247 2:193666272-193666294 ATGTTAGCTAAAGTGGGAAAGGG - Intergenic
944365911 2:198919379-198919401 ATGTCACCTGACATGGCAAAAGG - Intergenic
945224482 2:207519509-207519531 ATGTTTTCTCTCATGGCAAAAGG - Intergenic
945230977 2:207589499-207589521 ATGTTACCTTATATGGCAAAGGG - Intronic
945642752 2:212450280-212450302 ATATTAACTTACATGGCAATAGG + Intronic
945807731 2:214510876-214510898 ATGTTACCTTACATGGCAAAGGG + Intronic
945817088 2:214618807-214618829 ATGTTTAATGACATGGAAAATGG - Intergenic
945821738 2:214673412-214673434 ATGTTACCTTCCATGGCAAAAGG - Intergenic
945915557 2:215700482-215700504 ATCTCAATTTACATGGGAAAAGG + Intergenic
946543437 2:220711121-220711143 ATGTTATCTTTCGTGGGAAATGG + Intergenic
947477747 2:230466223-230466245 ATGACAACTGACATGGCAAATGG - Intronic
947923972 2:233904900-233904922 ATGTCAAGTCACATGGAAAGGGG - Intergenic
947945080 2:234094132-234094154 ATGTGACCTCAGATGGGAAAAGG + Intergenic
947985413 2:234443687-234443709 ATGTTACCTTATATGGAAAATGG + Intergenic
948036968 2:234865579-234865601 ATGTTACCATACATGGCAAAGGG - Intergenic
948125279 2:235560453-235560475 ATGTTACCTCACATGGCAAAAGG + Intronic
948209356 2:236180958-236180980 ATCTTAGCTCACATGATAAAGGG - Intergenic
948285887 2:236784866-236784888 ATGGTATCTCACATGGCAGAAGG - Intergenic
948371962 2:237495304-237495326 ATGTCACCTCACATAGCAAAAGG - Intronic
948435204 2:237948619-237948641 ATGTTGCCTCACAAGGCAAAAGG - Intergenic
1168802221 20:650913-650935 GTGTTACCTTACATGGGAGAAGG + Intronic
1169247833 20:4037851-4037873 ATATTACCTCACATGGCACAAGG - Intergenic
1169416802 20:5424138-5424160 ATGTTATCTTACTTGGCAAAAGG - Intergenic
1169532044 20:6495812-6495834 TGGCTAAGTCACATGGGAAAAGG + Intergenic
1169756214 20:9046057-9046079 ATGTTATTTTACATGGCAAAAGG + Intergenic
1170017989 20:11803712-11803734 ATGTTAGGTCACATGACAAAGGG - Intergenic
1170032136 20:11954960-11954982 ATGTTACCTTAAATGGCAAAAGG + Intergenic
1170192235 20:13655767-13655789 ATGTAATTTCACATGGCAAAAGG + Intergenic
1170413924 20:16120412-16120434 ATGTTACCTTACATGGCAAAAGG - Intergenic
1170717380 20:18843704-18843726 ATGTTACCTTCCATGGGAAAGGG - Intergenic
1170730006 20:18965580-18965602 ATATTACTTTACATGGGAAAAGG + Intergenic
1172016117 20:31874341-31874363 ATGTTATATTACATGGCAAAGGG + Intronic
1172046335 20:32083282-32083304 ATGTTACCTTACATGGTAAAAGG - Intronic
1172049128 20:32102972-32102994 ATGTTACCTCACATGGCAAAAGG - Intergenic
1172181315 20:33005371-33005393 ATGTTAAGTCACAAGGCAAAAGG + Intergenic
1172391876 20:34570983-34571005 ATGTCAACACACATGAGTAATGG + Intronic
1172593315 20:36132501-36132523 ATGTTACCTCACGTGGCAAAAGG - Intronic
1172886596 20:38235371-38235393 ATGTTACCTTACATGGCAAAAGG + Intronic
1173072649 20:39784185-39784207 TTGTTACCTCAAATGGCAAAAGG + Intergenic
1173573694 20:44096173-44096195 ATGTTACCTTGCATGGCAAAAGG - Intergenic
1173676900 20:44843801-44843823 ATGTTAGGTTACATGGCAAAGGG - Intergenic
1173888420 20:46481898-46481920 GTGTTACCTTACATGGTAAAAGG + Intergenic
1174419764 20:50391801-50391823 ATGTGACCTTACATGGCAAAGGG + Intergenic
1174661261 20:52215170-52215192 ATGTTACCTTACAGGGCAAAAGG + Intergenic
1174711613 20:52711993-52712015 ATGTTACCTTACATGGAAAAGGG - Intergenic
1174856488 20:54050298-54050320 ATGTGACCTTACATGGCAAAAGG - Intronic
1174911721 20:54615333-54615355 ATGTTACCTTACAAGGCAAAAGG + Intronic
1175059188 20:56226377-56226399 ATGTTACCTTACATGGCAACAGG + Intergenic
1175148467 20:56914150-56914172 ATGTCACCTTACATGGCAAAAGG + Intergenic
1175478724 20:59296285-59296307 ATGTCAACTAACATGGCAAAAGG - Intergenic
1175711910 20:61228057-61228079 ATGGTACCTCACGTGGCAAAAGG + Intergenic
1176995443 21:15550090-15550112 ATGTTACCTTACTTGGAAAAAGG - Intergenic
1178020652 21:28404566-28404588 ATGTTACCTTGCATGGCAAAAGG - Intergenic
1178258134 21:31074129-31074151 ATGTTACCTAACATGGCAAAAGG - Intergenic
1178933297 21:36838365-36838387 ATGTTTACTTACTTGGAAAAAGG + Intronic
1179038564 21:37781958-37781980 ATGTTACTTTACATGGCAAAAGG + Intronic
1179200217 21:39211321-39211343 ATGTTGCCTTACATGAGAAAAGG + Intronic
1179252618 21:39685161-39685183 ATGTTAGATTACATGGCAAAGGG - Intergenic
1179335600 21:40449255-40449277 ATGTTACATTCCATGGGAAAAGG - Intronic
1179537733 21:42063204-42063226 ATGTCAACTTACTTGGAAAAAGG - Intronic
1179591889 21:42414533-42414555 ATGTGACCTCACTTGGGAATAGG + Intronic
1181393338 22:22599899-22599921 ATGGGAACTTACATAGGAAAAGG - Intergenic
1181812318 22:25411136-25411158 ATGTTAACCGAGTTGGGAAAAGG + Intergenic
1181990439 22:26832865-26832887 ATGTTATCTTACATGGCAAAAGG - Intergenic
1182004104 22:26944754-26944776 ATGTTACCTTACATGGCAAAAGG - Intergenic
1182127371 22:27825855-27825877 ATGTTACCTTACAGGGCAAAAGG - Intergenic
1182164210 22:28156162-28156184 ATGTTACCTTACATGGCAAAAGG + Intronic
1182533015 22:30976190-30976212 ATTTTAAATCACATGAGAAGGGG - Intergenic
1183125148 22:35771135-35771157 ATGTTACCTTACACGGCAAAAGG + Intronic
1183208270 22:36433917-36433939 GTGTTAACCTACATGGCAAAAGG - Intergenic
1183209813 22:36443909-36443931 ATATTACCTTACATGGCAAAAGG + Intergenic
1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG + Intronic
1183514878 22:38259345-38259367 ATGCTACCTTACATGGCAAAAGG + Intronic
1184931970 22:47688007-47688029 ATGTCACCTTACATGGCAAAAGG - Intergenic
1185009768 22:48306477-48306499 ATGTCAAGACACATGGGAGAAGG - Intergenic
949226644 3:1702898-1702920 ATGTTAGGTTACATGGTAAAGGG - Intergenic
949264548 3:2141208-2141230 ATGCTACCTCACATGGCAAAAGG + Intronic
949372688 3:3352738-3352760 ATGTTATCTTGCATGGCAAAAGG + Intergenic
949401414 3:3668853-3668875 ATGTTACGTTACATGGCAAAAGG - Intergenic
949485884 3:4537505-4537527 ATGTTACCTCATATGGTATAGGG + Intronic
949521331 3:4856915-4856937 ATGTTGCCTTACATGGCAAAAGG - Intronic
949644549 3:6077911-6077933 ATGTTACCTGACATGGCAAAGGG + Intergenic
950570179 3:13794938-13794960 ATGTTACCTTATATGGCAAAAGG + Intergenic
950796403 3:15513847-15513869 ATGTTACCTTATATGGAAAATGG + Intronic
951002944 3:17585209-17585231 ATGTTAAATAAAATGGGAATGGG + Intronic
951281674 3:20757905-20757927 ATGATTACTGACATTGGAAAAGG + Intergenic
951313311 3:21157507-21157529 ATGTTATCTCACTTGGCAAAAGG - Intergenic
951472493 3:23071259-23071281 ATATTTACTTACATGAGAAATGG - Intergenic
951594422 3:24301733-24301755 ATGCTATCTTACATGGCAAAAGG + Intronic
952810709 3:37400068-37400090 ATGTTAATTATCATGGGAATGGG - Intronic
953049652 3:39329051-39329073 ATGTTCACTCTCCTGGGATAGGG + Intergenic
953274725 3:41483702-41483724 ATATGATCTTACATGGGAAAAGG + Intronic
953416576 3:42723406-42723428 ATGTTAACTTACATGGCCAAGGG - Intronic
953852308 3:46473807-46473829 ATGTTAGCTTAAATGGCAAAAGG - Intronic
954391444 3:50270000-50270022 ATGTAAACTCACATGTGTACAGG + Intronic
954623701 3:52010565-52010587 ATGTTACTTAACATGGCAAAGGG + Intergenic
954850595 3:53596479-53596501 ATGTTACCTTACATGGCAAAAGG + Intronic
955169600 3:56550398-56550420 ATGTAACCTTACATGGCAAAGGG - Intergenic
955223175 3:57039885-57039907 GTGTTACCTTACATGGAAAAAGG - Intronic
955375740 3:58395283-58395305 ACCTTTCCTCACATGGGAAAAGG - Intronic
955463192 3:59208176-59208198 ATGTTACCTTACATGGCAAAAGG + Intergenic
955532680 3:59890548-59890570 ATGTTAATTCATATGCAAAATGG + Intronic
955679993 3:61490178-61490200 ATGTTACCTTACATGGCAAAAGG + Intergenic
955896591 3:63707084-63707106 ATGTTACCTTACATGGCAAGAGG - Intergenic
956062466 3:65361529-65361551 ATGCCAAATCACATGAGAAAGGG + Intronic
957617608 3:82551465-82551487 ATGTTATCTCACATATCAAAAGG - Intergenic
957637814 3:82809390-82809412 ATGTTATGTTACATGGCAAACGG + Intergenic
957669170 3:83278424-83278446 ATGTTTCCTCACATGGGGGAAGG - Intergenic
958009440 3:87857821-87857843 ATGTTACCTTACATGGGGAAAGG - Intergenic
958501651 3:94918367-94918389 ATGTGACCTTACATGGTAAAAGG - Intergenic
958572293 3:95902281-95902303 ATGTTAACTTAAATAGTAAATGG - Intergenic
958860715 3:99442296-99442318 ATGTTACATCACATGGCAAATGG - Intergenic
959021214 3:101189272-101189294 ATGTTCACTTACATGGCAAAAGG - Intergenic
959120543 3:102227064-102227086 ATGTTACCTTACATGGCAAAAGG - Intronic
959167071 3:102793780-102793802 ATGTTACCTTACATGGCAAAGGG + Intergenic
959283425 3:104377444-104377466 ATGTTACCTTACATGGAAAAAGG + Intergenic
959716615 3:109440604-109440626 ATGTTACCTTACACGGCAAAAGG - Intergenic
959861937 3:111226315-111226337 ATGTAACCTTACATGGCAAAAGG - Intronic
959908016 3:111731778-111731800 ATGTTATCTTACATGGTAAAAGG - Intronic
960085887 3:113590937-113590959 ATGTTACCTTACCTGGCAAAAGG + Intronic
960170946 3:114460337-114460359 ATGTTACCTTACGTGGCAAAGGG + Intronic
960300943 3:116001888-116001910 ATGCTACCTTACATGGCAAAAGG - Intronic
960344079 3:116510933-116510955 ATGTGAACTTATTTGGGAAAAGG + Intronic
960856928 3:122111392-122111414 ATGTTATCTTACATGGCAAAAGG + Intronic
960897984 3:122526226-122526248 ATGTTACCTTACATGGCAAAAGG - Intergenic
961078726 3:124005900-124005922 ATGTTACCTTACAGGGCAAAGGG + Intergenic
961345714 3:126262034-126262056 ATGTCACCTTACATGGCAAAGGG + Intergenic
961669192 3:128516757-128516779 ATGTCACCTCACATGCCAAAGGG + Intergenic
961760502 3:129163871-129163893 ACGTTACCTTACATGGCAAAAGG + Intergenic
961773905 3:129270175-129270197 ATGTTACCTTGCATGGTAAAAGG - Intronic
962363220 3:134758861-134758883 GTGTTACCTCCCATGGTAAAAGG + Intronic
962444900 3:135455494-135455516 ATGTTATCTTACATGGCAACAGG - Intergenic
962886518 3:139632842-139632864 ATGTTATATTACATGGCAAAAGG + Intronic
962914541 3:139888026-139888048 ATGTTACCTTACATAGCAAAGGG - Intergenic
963110784 3:141686200-141686222 ATGTCACTTCACATGGCAAAAGG + Intergenic
964020045 3:151999122-151999144 ATGTTACCTTACATGGTGAAGGG + Intergenic
964465318 3:156985501-156985523 ATGTTCCCTTACATGGCAAAAGG + Intronic
964466912 3:157003698-157003720 ATGTTTCCTTATATGGGAAAAGG - Intronic
964702034 3:159578911-159578933 ATGCTATTTCACATGGCAAAGGG - Intronic
964723831 3:159794071-159794093 ATGCTACTTCACATGGCAAAAGG - Intronic
964813505 3:160691770-160691792 ACGTTACCTCACATGGTAAAAGG + Intergenic
964894966 3:161584610-161584632 AGGTTAACTTACATGGCAAAAGG - Intergenic
965033715 3:163406850-163406872 CTGTTAACTCTTATGGTAAAAGG - Intergenic
965217929 3:165888255-165888277 ATGTTACCTTACATGGCAAAAGG - Intergenic
965427390 3:168544566-168544588 ATGTTACCTTACATGACAAAGGG + Intergenic
965555960 3:170018663-170018685 ATGTTACCTTACCTGGCAAAAGG - Intergenic
966101306 3:176271778-176271800 CTGTTACCTTACATGGCAAAAGG + Intergenic
966246454 3:177813310-177813332 ATGTTACCTTACATGACAAAGGG + Intergenic
966482042 3:180421212-180421234 ATGTTAAGTTACATGGCAAAGGG + Intergenic
967000257 3:185327353-185327375 ATGTTACCTTCCATGGCAAAAGG - Intronic
967311752 3:188112826-188112848 ATGTTATGTTACATGGCAAAGGG - Intergenic
967414619 3:189202353-189202375 ATGAAACCTCAAATGGGAAATGG + Intronic
967770386 3:193328069-193328091 CTGTTAACTCAGTTGTGAAATGG - Intronic
967794721 3:193587520-193587542 ATGTTACCTTACTTGGAAAAGGG - Intronic
967924916 3:194638487-194638509 ATGTTACCTTATATGGAAAAAGG - Intergenic
967991859 3:195137440-195137462 ATGTTTTCCCACATGGGTAAAGG + Intronic
968039328 3:195575368-195575390 ATGTTACTTTGCATGGGAAAAGG - Intronic
969240936 4:5897006-5897028 ATGTTACTCCACATGGCAAATGG + Intergenic
969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG + Intronic
969342763 4:6552702-6552724 TTGTTACCTTACATGGCAAAAGG - Intronic
969377426 4:6772007-6772029 ATGTTACCTTACCTGGCAAAAGG - Intergenic
969496125 4:7527276-7527298 ATGCTACCTTACATGGCAAAGGG + Intronic
969833357 4:9817236-9817258 ATGTTAACTTACAGGGCAAATGG - Intronic
969951000 4:10835522-10835544 ATGTGTCCTCACATGGCAAAAGG + Intergenic
970466771 4:16331811-16331833 ATGTTACCTCATGTGGCAAAAGG - Intergenic
970466859 4:16332865-16332887 ATGTTACCTCACGTGGCAAAAGG - Intergenic
970493399 4:16599500-16599522 ATGTGACCTTACATGGCAAAAGG - Intronic
970602809 4:17653756-17653778 ATGTTACCTTACATGGTCAAAGG + Intronic
970680660 4:18503906-18503928 ATATTACCTCATATGGAAAAAGG - Intergenic
970814286 4:20135671-20135693 ATGTTACCTTACATGGCAAAAGG - Intergenic
970881777 4:20941089-20941111 ATGTCAACTCTCATGGGGAAAGG - Intronic
970899149 4:21138631-21138653 ATGTTAACTTACATACTAAAAGG + Intronic
971040350 4:22744779-22744801 ATGTTACCTTCCATGGCAAAAGG - Intergenic
971264257 4:25084266-25084288 ATGTTACCTTACATGACAAAAGG + Intergenic
971788088 4:31130967-31130989 ATGTTAGGTAACATGGTAAAGGG - Intronic
971813666 4:31460636-31460658 ATGTTACCTTACATGGCCAAAGG + Intergenic
971893815 4:32563269-32563291 ATGTTATCTTACATGGCAAATGG - Intergenic
971985220 4:33813370-33813392 ATGTTACCATACATGGCAAAAGG - Intergenic
972080086 4:35139639-35139661 ATGGTATCTTACATGGCAAAAGG - Intergenic
972233249 4:37099662-37099684 ATGTTACATTACATGGCAAAAGG + Intergenic
972247948 4:37265840-37265862 ATGTTACCTTATATGGCAAAGGG - Intronic
972791526 4:42375712-42375734 ATGTTACCTTACATGGCAAACGG - Intergenic
972955094 4:44379148-44379170 ATGTTACTTCATATGGCAAAAGG - Intronic
973025295 4:45261348-45261370 ATGGCAAATCACATGGCAAAAGG + Intergenic
973110943 4:46397222-46397244 ATATTCACACTCATGGGAAAAGG - Intronic
973216249 4:47672775-47672797 CTGTTCTCTCATATGGGAAATGG + Intronic
973334062 4:48938240-48938262 ATGTTTCCTTACATGGTAAAAGG + Intergenic
973875408 4:55213352-55213374 ATGTTATCTAACATGGGAAAAGG - Intergenic
974022735 4:56706161-56706183 ATGTTACCTTACATAGCAAAGGG + Intergenic
974158771 4:58109668-58109690 ATGCAAATTCACATGGCAAAAGG - Intergenic
974195698 4:58571667-58571689 ATGTTACATTACATGGCAAAGGG - Intergenic
974209682 4:58753775-58753797 ATTTTGACAGACATGGGAAATGG - Intergenic
974482585 4:62465495-62465517 ATGTTATCTTACATGGCAAAAGG - Intergenic
974754727 4:66188122-66188144 ATCATAAGTCACATAGGAAAAGG + Intergenic
974802846 4:66840964-66840986 ATGTTAATTTACATATGAAATGG - Intergenic
975439256 4:74392132-74392154 ATGTTACCTTCCATGGTAAAAGG + Intergenic
975597244 4:76060580-76060602 ATGTTATATTACATGGCAAAAGG + Intronic
975604161 4:76136542-76136564 ATGTTATCTTACATAGCAAAAGG + Intronic
975626016 4:76348077-76348099 ATGTGTCCTCACATGGGAGAAGG + Intronic
975713929 4:77187696-77187718 CTGTGTACTCACATGGTAAAAGG - Intronic
975796749 4:78014209-78014231 ATGTTGACCCACACTGGAAAGGG - Intergenic
975799035 4:78039464-78039486 ATGTTATCTTATATGGCAAAAGG + Intergenic
976063901 4:81161872-81161894 ATGTTATATTACATGGCAAAAGG - Intronic
976141781 4:82000566-82000588 ATGTTAGATCACATGGCAAAGGG - Intronic
976348008 4:84027471-84027493 ACGTTACCTTACATGGCAAAAGG - Intergenic
976588050 4:86820657-86820679 ATGTTCAGGCACATGGGACATGG - Intergenic
976648832 4:87413724-87413746 ATGTTACCTAACATGAAAAAAGG + Intergenic
976830730 4:89310628-89310650 ATATTACCTTACATGGCAAAGGG - Intergenic
976838851 4:89407651-89407673 ATGTTACCTGATATGGCAAAAGG + Intergenic
976850500 4:89539829-89539851 ATGTGAAGTCACAGTGGAAATGG - Intergenic
977095376 4:92736034-92736056 ATGTTAACTTACATGACAAAAGG + Intronic
977175565 4:93815718-93815740 ATGTTACTTTACATGGCAAAGGG + Intergenic
977449870 4:97181678-97181700 ATGTTTACTCACATTAGAATTGG + Intergenic
977576980 4:98685240-98685262 ATGCTACCTCACGTGGCAAAAGG - Intergenic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
977727503 4:100313991-100314013 TTGTTATTTCACATGGGAATTGG - Intergenic
977833621 4:101621296-101621318 AGATTAATTCAAATGGGAAAAGG + Intronic
978017030 4:103757128-103757150 ATGTTATCTTATATGGCAAAAGG - Intergenic
978744475 4:112176067-112176089 CTGTTTACTCACTTTGGAAAGGG - Intronic
978744610 4:112178220-112178242 ATGATATCTTACATGGCAAAAGG + Intronic
978806196 4:112803251-112803273 ATGTTACCTTACTTGGAAAAGGG + Intergenic
980106568 4:128594137-128594159 ATGTTACCTTGTATGGGAAAAGG - Intergenic
980220516 4:129907768-129907790 ATGTGTCCTTACATGGGAAAAGG - Intergenic
980322826 4:131302028-131302050 ATGTTAAGCCACATGGGCTAAGG - Intergenic
980586629 4:134825551-134825573 ATGTGTTCTCACATGGCAAAAGG - Intergenic
980774777 4:137423471-137423493 ATGTCTACTCACATTGAAAAAGG + Intergenic
980880305 4:138703434-138703456 ATGTTACCTTACGTGGCAAAAGG - Intergenic
981360883 4:143844537-143844559 ATGCAAAGTCACATGGCAAAGGG + Intergenic
981371623 4:143965528-143965550 ATGCAAAGTCACATGGCAAAGGG + Intergenic
981380710 4:144068736-144068758 ATGCAAAGTCACATGGCAAAAGG + Intergenic
981425346 4:144596290-144596312 ATGTTATTTTACATGGCAAAAGG - Intergenic
981561069 4:146048966-146048988 ATGTTACCTTACATGGCAAAAGG - Intergenic
981722459 4:147815405-147815427 ATGTTATTTTACATGGCAAAAGG + Intronic
981765176 4:148240831-148240853 TAGTTACCTCACCTGGGAAATGG + Intronic
981950959 4:150406737-150406759 ATGCTACATTACATGGGAAAAGG + Intronic
982086967 4:151845389-151845411 ATGTTAGCATACATGGCAAAAGG + Intergenic
982219651 4:153113669-153113691 AAGTCAACTCACAATGGAAATGG - Intergenic
982320584 4:154072902-154072924 GTGTTACCTTACATGGTAAAGGG + Intergenic
982325171 4:154122502-154122524 AGATTAACTCACCTGGGCAATGG - Intergenic
982802817 4:159725226-159725248 ATGTTATTTTACATGGAAAAAGG + Intergenic
982852985 4:160342463-160342485 TTGTTCACTCCCATGGAAAAGGG - Intergenic
982942358 4:161574198-161574220 ATGTTACCTTATATGGCAAAGGG - Intronic
983018222 4:162641057-162641079 ATGTTACCTCACAAGGCAAAGGG + Intergenic
983051474 4:163052667-163052689 ATGATAACTAAAATGGAAAATGG + Intergenic
983285874 4:165738398-165738420 ATGTTAACTTATATGGCAACAGG + Intergenic
983344569 4:166510445-166510467 ATGTTACCTTACATGGCAAAAGG + Intergenic
983855312 4:172636385-172636407 ATGTTTCCTTACATGGCAAAAGG + Intronic
983951360 4:173646443-173646465 ATGTTAAGTTACATGGCAAAGGG + Intergenic
984418683 4:179492255-179492277 ATGTTACCTTACATGGTAAAAGG + Intergenic
985496551 5:210149-210171 AAATTAACTCAAATGGGTAAGGG + Intronic
986244310 5:5991437-5991459 ATGTTACCTTATATGGTAAAAGG + Intergenic
986605035 5:9514320-9514342 ATGTTACCTGACATGGCAAAAGG - Intronic
986658920 5:10041728-10041750 ATGTTAGGTTACATGAGAAAGGG - Intergenic
986769334 5:10957644-10957666 ATGTTATCTTACATGGCAAGAGG + Intergenic
987022821 5:13892331-13892353 ATGTTACCTTATATGGCAAAAGG + Intronic
987246063 5:16050011-16050033 ATGTCACCTTACATGGCAAAAGG + Intergenic
987824319 5:23008707-23008729 ATGTGTTCTCACATGGGAGAAGG - Intergenic
987918140 5:24242773-24242795 ATGTTACCTTACTTGGAAAAAGG - Intergenic
988101924 5:26690642-26690664 ATATTACCTTACATGGCAAAAGG + Intergenic
988600172 5:32632344-32632366 ATGTTTCCTCACATGGCAGAAGG - Intergenic
988710419 5:33768898-33768920 ATGTTAGATTACATGGTAAAGGG + Intronic
988771453 5:34437210-34437232 ATGTTATCTCATTTGGCAAAAGG + Intergenic
989001631 5:36766796-36766818 CTGTTACCTTACATGGCAAAGGG - Intergenic
989136101 5:38156533-38156555 ATGTTACCTTACATGGCAAAAGG - Intergenic
989650812 5:43688140-43688162 ATTTTACCTTACATGGCAAAAGG + Intronic
990148646 5:52790752-52790774 ATGTTATCTTAGATGGTAAAAGG - Intronic
990220142 5:53579480-53579502 ATGTTACCTTATATGGCAAAAGG + Intronic
990283499 5:54276639-54276661 ATGTTATCTTACATGGCAAAAGG + Intronic
990374082 5:55151895-55151917 ATGTTACTTCATATGGCAAAGGG + Intronic
990516504 5:56535520-56535542 ATGTTACCTTATATGGCAAAAGG - Intronic
990620698 5:57555817-57555839 ATGTTACCTTACATGGCAAAAGG - Intergenic
990659903 5:58001723-58001745 ATGTTACCTTACGTGGCAAAAGG - Intergenic
990837376 5:60037070-60037092 AGGTTAATTCACATAGGAATAGG + Intronic
990985418 5:61637009-61637031 AGGTTACCTCAAATGGCAAAAGG - Intergenic
991040722 5:62172711-62172733 ATATTATCTTACATGGCAAAAGG - Intergenic
991185334 5:63800103-63800125 ATGTTACTTTACATGGCAAAAGG - Intergenic
991398788 5:66232629-66232651 ATGTAATTTCAAATGGGAAAAGG - Intergenic
991629098 5:68636033-68636055 TATTTAACTCCCATGGGAAATGG + Intergenic
992658445 5:78933763-78933785 ATGTTACCTTACATGGCAACGGG + Intronic
993483294 5:88451068-88451090 ATGTTACCTTTCATGGCAAAGGG - Intergenic
993731537 5:91428678-91428700 ATGTTACCTTACACGGCAAAAGG + Intergenic
993832016 5:92771524-92771546 ATGTTACCTTACAAGGCAAAAGG - Intergenic
994048022 5:95330990-95331012 ATGTGACCTTACATGGAAAAAGG + Intergenic
994275936 5:97837331-97837353 ATGTTACCTTACATGGCAAAGGG - Intergenic
994389732 5:99177555-99177577 ATAGTATATCACATGGGAAAGGG - Intergenic
994447955 5:99901782-99901804 ATGTTACCTAACAGGGCAAAAGG + Intergenic
994456551 5:100015752-100015774 ATGTTACATTACATGGCAAAGGG - Intergenic
994577077 5:101591879-101591901 ATGTTAAGTTATATGGCAAAAGG - Intergenic
994580722 5:101638473-101638495 AAGTTAGCTCACATGTGAAATGG - Intergenic
994667819 5:102728071-102728093 ATGTTACCTTACATAGCAAAAGG + Intergenic
994739043 5:103595304-103595326 ATGTTACCTTACATGGCAAAAGG - Intergenic
994947193 5:106410152-106410174 ATGTTACACCACATGGCAAAGGG + Intergenic
994977018 5:106820790-106820812 ATGTTATCTTACATGGCAAAAGG - Intergenic
995281120 5:110336927-110336949 ATGATACCTTACATGGCAAAAGG + Intronic
995405975 5:111796376-111796398 ATGTTATCTTACATGGCAAAGGG - Intronic
995541837 5:113193298-113193320 ATTTTACCTTACATGGTAAAAGG - Intronic
995627795 5:114098254-114098276 ATGTTCCCTTACATGGTAAAAGG - Intergenic
995774444 5:115710668-115710690 ATGTTAACTTACACAGCAAAAGG - Intergenic
995841978 5:116451091-116451113 ATGTTAAGTCACTTGCCAAAAGG - Intronic
996356845 5:122604884-122604906 ATGCTTACTAAGATGGGAAAGGG - Intergenic
996624821 5:125557829-125557851 ATGTTATCTTACATGGTACAAGG - Intergenic
996642779 5:125777089-125777111 ATGTTACCTTATATGGCAAAGGG - Intergenic
997100645 5:130965208-130965230 ATGTTACCTTACATGGCAAAAGG + Intergenic
997298701 5:132786258-132786280 ATCTTACCTTACATGGCAAAGGG + Intronic
998298159 5:140991903-140991925 ATGTTATGTTACATGGCAAAAGG - Intronic
998305104 5:141068346-141068368 ATGTTATGTTACATGGCAAAGGG - Intergenic
999003967 5:147955577-147955599 ATGTTACCTTACATGGCAAAAGG + Intergenic
999063126 5:148656221-148656243 ATGTTACCTTGCATGGCAAAAGG + Intronic
999684732 5:154091975-154091997 GTGTTACCTTACATGGCAAAAGG + Intronic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
1000287403 5:159838449-159838471 ATGTTACCTTACCTGGAAAAAGG + Intergenic
1000397461 5:160790772-160790794 ATGTTACATCACATGGCAAAGGG + Intronic
1000428693 5:161124242-161124264 ATGTGAACTTACATGGCAAAAGG + Intergenic
1000909042 5:166998755-166998777 ATGTGAACACACATGGGATGTGG + Intergenic
1000921639 5:167145177-167145199 ACGTTACCTTACATGGTAAAAGG - Intergenic
1001102737 5:168827642-168827664 ATGTTGTCTTACATGGCAAAAGG - Intronic
1001138698 5:169124864-169124886 ATGTTAGCTCATATGTGAAGAGG - Intronic
1001172035 5:169428481-169428503 ATGTTATCTCACATGGCAAAAGG + Intergenic
1001270415 5:170307076-170307098 ACGTTAAGTTACATGGAAAAGGG + Intergenic
1001698131 5:173687818-173687840 ATGTAATCTTACATGGCAAAAGG - Intergenic
1001784258 5:174398336-174398358 ATGTTACCTTAAATGGCAAAAGG + Intergenic
1001813160 5:174646075-174646097 ATGTCACCTTACATGGCAAAAGG - Intergenic
1001840542 5:174872708-174872730 ATTTTTACTGAAATGGGAAAAGG - Intergenic
1001888291 5:175316166-175316188 ATCTTAAGTTACATGGCAAAAGG + Intergenic
1001907559 5:175485592-175485614 ATGTTACCTCACATGGTGCAGGG - Intronic
1002604240 5:180372376-180372398 ATGTGGACTCACATGTGAAATGG + Intergenic
1002988317 6:2213468-2213490 ATGTAAACTCACTTTGAAAAAGG + Intronic
1003268077 6:4584017-4584039 ATGTTACCTTACATGGCCAAAGG - Intergenic
1003981277 6:11392490-11392512 ATGTTACCTTACATGGCAAAAGG - Intergenic
1004003371 6:11616192-11616214 ATGTTGACTCACTTTGCAAAAGG - Intergenic
1004274053 6:14220318-14220340 GTGTTACCTGACATGGCAAAAGG + Intergenic
1004987151 6:21095391-21095413 ATGTTCACACAAGTGGGAAAAGG - Intronic
1004990575 6:21133234-21133256 ATCCTAAATCAAATGGGAAATGG + Intronic
1004999237 6:21224172-21224194 ATGTTACCTTACATGGCAAAAGG + Intronic
1005204953 6:23392226-23392248 ATGTTAGCTTGCATGGCAAAAGG + Intergenic
1005761841 6:28974570-28974592 ATGTTAACTTACATGGCAAAGGG + Intergenic
1005774828 6:29119669-29119691 ATGTTACTTTACATGGCAAAAGG + Intergenic
1005781026 6:29192393-29192415 ATGTTACTTTACATGGCAAAAGG - Intergenic
1005902603 6:30230541-30230563 ATGTTACCGTACATGGCAAAAGG + Intergenic
1006206722 6:32350652-32350674 ATGTTAGGTTACATGGAAAAAGG + Intronic
1006252420 6:32798970-32798992 CTGTTACCTTACATGGCAAAAGG + Intergenic
1007238401 6:40407415-40407437 CTGTTTCCTCACATGTGAAATGG + Intronic
1007852033 6:44812559-44812581 ATGTTACATCACATAGCAAAAGG - Intronic
1007934492 6:45721066-45721088 GTGTTATCTCACATGGCAAAAGG + Intergenic
1008132407 6:47733827-47733849 ATGTTAGGTTACATGGCAAAGGG + Intergenic
1008492885 6:52104227-52104249 AGGTTACCTTACATGGTAAAAGG + Intergenic
1008547094 6:52592698-52592720 ATGTTACCTTACATGGCAAAAGG - Intergenic
1008618158 6:53245932-53245954 ATGTTACCTTATATGGCAAAGGG - Intergenic
1008818844 6:55606733-55606755 ATGTTATTTTACATGGCAAAAGG + Intergenic
1009404166 6:63291823-63291845 ATGTTAAATTGCATGGCAAAAGG + Intronic
1009443941 6:63716930-63716952 ATGTTAGGTTACATGGGAATAGG - Intronic
1009540415 6:64949298-64949320 ATGTGATCTCACCTAGGAAATGG + Intronic
1009649181 6:66451385-66451407 ATGTTACTTTACATGGCAAAGGG + Intergenic
1009761326 6:68010528-68010550 ATGTTACCTTACATGGCAAAAGG + Intergenic
1010572720 6:77497081-77497103 ATGTCACCTTACATGGCAAAGGG - Intergenic
1010680149 6:78789649-78789671 ATGTTAGGTTACATGGTAAAGGG + Intergenic
1010736129 6:79445229-79445251 ATGTTACCTTACTTGGAAAAGGG + Intergenic
1010812660 6:80317643-80317665 ATGTTACCTTACATGGCAAAAGG - Intronic
1010865058 6:80966181-80966203 ATGTTACCTTACATGTTAAAAGG - Intergenic
1011010787 6:82701749-82701771 ATGTTACCTTACCTGGCAAAAGG - Intergenic
1011476691 6:87755551-87755573 ATGTTACCTTACATGGCAAAAGG - Intergenic
1011494795 6:87927248-87927270 ATGTAAACTCAGATCGCAAAAGG - Intergenic
1011597110 6:89026497-89026519 ATGTTATTTTACATGGTAAAAGG + Intergenic
1011753347 6:90475132-90475154 ATGTTAGCTTACATGGCAAAAGG - Intergenic
1012009937 6:93770733-93770755 ATGTTAAGTGACATGGCAAATGG - Intergenic
1012228011 6:96726958-96726980 ATGTTACCTTATATGGCAAAAGG + Intergenic
1013129368 6:107217244-107217266 ATGTTACCTTACAAGGCAAAAGG + Intronic
1013425128 6:110004740-110004762 ATGTTACCTTACATTGCAAAAGG - Intergenic
1013572748 6:111446172-111446194 CTGTTAACTCTCATGGGAGTTGG - Intronic
1013754192 6:113441753-113441775 ATGTTAGGTTACATGGGAAGGGG - Intergenic
1013788716 6:113812069-113812091 GTGTTATCTCACATGGCCAAAGG - Intergenic
1013847672 6:114473668-114473690 ATGTTACTTTACATGGAAAATGG + Intergenic
1014270127 6:119327044-119327066 ATGTTATTTCACATGGCAAAGGG + Intronic
1014483200 6:121964533-121964555 ATGTTATATCACATTGGAAAGGG + Intergenic
1014801453 6:125782836-125782858 ATGTCACCTTACATGGCAAAAGG + Intronic
1015060906 6:128964220-128964242 GTGATATCTGACATGGGAAAGGG + Intronic
1015342929 6:132122846-132122868 ATGTACACTCAAATGGGAGAAGG - Intergenic
1015390386 6:132675095-132675117 ATGCTAACTGTCATGGGGAATGG - Intergenic
1016000490 6:139036350-139036372 ATGTTACCTTACATGGCAAAAGG - Intronic
1016393473 6:143598136-143598158 ATGTTACTTTACATGGCAAAAGG + Intronic
1017387012 6:153898154-153898176 ATGTTACCTTACATTGCAAAAGG + Intergenic
1017430920 6:154369898-154369920 ATGTTATTTTACATGGCAAAAGG - Intronic
1017552727 6:155526592-155526614 ATATTAACTTGCATGAGAAATGG + Intergenic
1017562217 6:155640596-155640618 ATGTTATCTTACAAGGCAAAAGG - Intergenic
1017744005 6:157430694-157430716 ACGTTAAGTGACATGGCAAAGGG - Intronic
1019875368 7:3806252-3806274 ACGTTACCTCACATGGGAAAGGG - Intronic
1020218776 7:6217827-6217849 ATGTTAACTTACATGACAAAAGG + Intronic
1020363220 7:7352382-7352404 ATGCTACCTTACATGGCAAAAGG + Intergenic
1020516705 7:9130528-9130550 ATGTTATTTTACATGGCAAAAGG - Intergenic
1020596733 7:10215568-10215590 ATGTTGACTTACATGACAAAAGG - Intergenic
1020744405 7:12064071-12064093 ATGTTACCTCTCATGGCCAAAGG + Intergenic
1020827384 7:13047012-13047034 ATGATATCTGACATGGGTAAAGG - Intergenic
1020910222 7:14120100-14120122 AAATGAACTCACCTGGGAAAGGG + Intergenic
1021022275 7:15616954-15616976 GTGTGAACTTACATGGTAAAGGG - Intronic
1021032682 7:15757496-15757518 ATGTTAATTAACATGGCAAAAGG - Intergenic
1021149655 7:17134226-17134248 ATGTTATCTTACATGGCAAAAGG + Intergenic
1021191675 7:17627594-17627616 ATGTTAGCTCACAAGGGCAGAGG + Intergenic
1021386510 7:20037492-20037514 ATGTTATCTTACATGGGAAAAGG + Intergenic
1021402269 7:20222827-20222849 ATGTTACCTGACATGGCAAAAGG - Intergenic
1021876908 7:25058163-25058185 ATGTTACCTTACATGACAAAAGG - Intergenic
1022356298 7:29617753-29617775 ATGTTACCTTACATGGCAAAGGG - Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022646417 7:32233029-32233051 ATCTTAACATGCATGGGAAAAGG + Intronic
1023672169 7:42588718-42588740 ATCTCAACTCACAGTGGAAAAGG - Intergenic
1023672611 7:42593915-42593937 ATGTTACCTTACATGACAAAAGG + Intergenic
1023686361 7:42739458-42739480 CTGTTAGCTTACATGGCAAAAGG - Intergenic
1023754226 7:43401097-43401119 ATGTTACCTTACATGGTAAAAGG - Intronic
1024755281 7:52522147-52522169 CTGTGACCTCACATGGCAAAGGG + Intergenic
1024786817 7:52917312-52917334 ATGTGACCTTACATGGAAAATGG + Intergenic
1025725513 7:64054484-64054506 ATGTTTATTCACAGGGCAAAGGG - Intronic
1026272783 7:68851116-68851138 ATGTTACTTCACATGGCAAAAGG - Intergenic
1026521350 7:71120843-71120865 GTGTTAGCTTACATGGCAAAAGG + Intergenic
1026839678 7:73663002-73663024 ATGTTACCTTACATGGCAACAGG - Intergenic
1027473430 7:78600611-78600633 CTATTAATTCACAGGGGAAAAGG + Intronic
1027593308 7:80141109-80141131 ATGTCACCTCACAGGGCAAAAGG - Intronic
1027686237 7:81281556-81281578 ATGTTCATTCACATGATAAATGG - Intergenic
1027848960 7:83424659-83424681 ATGTTACCTTACATGGCAAAAGG + Intronic
1027920003 7:84380993-84381015 ATGTTGCCTTACATGGCAAAAGG - Intronic
1028202214 7:87975044-87975066 ATGTTACCTCACATGGAAAAAGG - Intronic
1028241887 7:88431670-88431692 ATGTTAAATCACTCGAGAAAAGG - Intergenic
1028527676 7:91803411-91803433 ATGTTATCCTACATGGCAAAAGG - Intronic
1028893287 7:96012827-96012849 ATGTTACCTCAAGTGGCAAAAGG + Intronic
1029654694 7:101916545-101916567 TTGCTAACTGACATGGGACAGGG - Intronic
1030254466 7:107492801-107492823 ATGTTAACTTACATTGCAAAAGG - Intronic
1030300366 7:107968440-107968462 ATGTTACCTCATATGGCAAAAGG + Intronic
1030323910 7:108199782-108199804 ATGTCACCTTACATGGCAAAAGG - Intronic
1030548363 7:110927386-110927408 ATGTTACATTACATGGCAAAGGG + Intronic
1030570809 7:111220949-111220971 ATGTCCACCCACATTGGAAAGGG + Intronic
1031132043 7:117843881-117843903 ATGTTCCCTTACATGGCAAAAGG + Intronic
1031144867 7:117986509-117986531 ATCTTACCTTACATGGCAAAAGG - Intergenic
1031331046 7:120465002-120465024 ATGTTATCTTACATGGCAAAAGG - Intronic
1031429238 7:121646154-121646176 ATGTTATCTCACAAGGCAAAAGG - Intergenic
1031565680 7:123294421-123294443 ATGTTACCTTGCATGGCAAAGGG + Intergenic
1031731002 7:125300344-125300366 ATGTTAAATGACATGGGAAAAGG - Intergenic
1032123608 7:129174737-129174759 ATATTACCTCATATGGCAAAAGG - Intergenic
1032510763 7:132470554-132470576 AGGTTACCTAACATGGCAAAAGG + Intronic
1032592189 7:133201666-133201688 ATGTTACCTTAAATGGTAAAGGG - Intergenic
1033727833 7:144139238-144139260 ATTTTATCACACATGGCAAATGG - Intergenic
1034125868 7:148671125-148671147 ATGTTACCTTACATGGCAAAAGG + Intergenic
1034985104 7:155507529-155507551 ATGTTAAATCACAAGGAAACTGG - Intronic
1035173980 7:157037564-157037586 ATGTTAGGTTACATGGCAAAGGG + Intergenic
1035547032 8:489495-489517 CTGTTCACTCCCATGGGAACAGG - Intergenic
1036493253 8:9247182-9247204 ATGCTACCTCAAATGGCAAAAGG - Intergenic
1036625273 8:10465918-10465940 ATGTTAGCTTACATGGCAAAGGG + Intergenic
1037751456 8:21684959-21684981 AGGTGAACTCACATGGGAGTTGG - Intergenic
1038204658 8:25454573-25454595 ATGTTGAGGCACATGGAAAAAGG + Intronic
1038503228 8:28062788-28062810 GTGTTTACTAACATGAGAAAAGG + Intronic
1038684562 8:29704520-29704542 ATGTGTCCTCACATGGCAAAAGG + Intergenic
1039016804 8:33158430-33158452 ATGTTACCTTACATGGCAAAAGG - Intergenic
1039675319 8:39658274-39658296 ATGCTATTTCACATGGCAAAAGG + Intronic
1039997949 8:42550718-42550740 ATGTTACCTCACAAGACAAAAGG - Intronic
1040635080 8:49263838-49263860 ATGTTATTTTACATGGCAAAAGG + Intergenic
1040706408 8:50133819-50133841 ATGTAAACTCATTTGGAAAAGGG - Intronic
1041155036 8:54977039-54977061 ATGTTCACTCCCATGGAAAGGGG + Intergenic
1041395979 8:57391662-57391684 ATGTTACTTTACACGGGAAAAGG + Intergenic
1041474150 8:58244709-58244731 ATGTTACCTTACATGCCAAACGG - Intergenic
1041734022 8:61091033-61091055 CCGTTACCTCACATGGCAAAAGG + Intronic
1041734193 8:61092807-61092829 ATGTTATGACACATGGGAAAGGG - Intronic
1042176404 8:66041085-66041107 GTGTTAACTTACTTGGGAAAGGG - Intronic
1042480659 8:69298430-69298452 ATGTTGTCTTACATGGCAAAAGG - Intergenic
1042525587 8:69761533-69761555 ATGTTATCTTACATGGCAAGAGG - Intronic
1042928118 8:73987722-73987744 ATATTACCTTACATGGCAAAAGG + Intergenic
1043447764 8:80335912-80335934 ATGTTACATTACATGGCAAAGGG - Intergenic
1043534823 8:81191093-81191115 ATGTTACCTTAAATGGTAAAAGG + Intergenic
1043848647 8:85190422-85190444 ATGTTCAGTTACATAGGAAAGGG + Intronic
1043986989 8:86705458-86705480 ATGTTACATTACATGGCAAAAGG + Intronic
1044226495 8:89724893-89724915 ATATTACCTCACATGGCAAGAGG - Intergenic
1044277001 8:90312871-90312893 ATGTTACCTTACATGCCAAAAGG + Intergenic
1044300847 8:90581245-90581267 ATGTTACCTTATATGGCAAAAGG - Intergenic
1044355298 8:91215158-91215180 ATGTCACCTCACATAGCAAAAGG - Intronic
1044446569 8:92284144-92284166 GTATTAACTCGCATGTGAAATGG + Intergenic
1044593446 8:93936182-93936204 ATGTTGACTGACTTGTGAAATGG - Intergenic
1044828192 8:96219205-96219227 ATGTTAACCTACATGGAAAAAGG + Intergenic
1044828344 8:96220245-96220267 ATGTTAACCCACATGGCAAAAGG + Intergenic
1044888245 8:96803275-96803297 ATGTTAACCCACATTGGGGAGGG + Intronic
1045340112 8:101246132-101246154 ATGTTACCTTACATGACAAAAGG + Intergenic
1045607899 8:103798789-103798811 ATGTTACCTTACCTGGCAAAGGG + Intronic
1045640116 8:104240238-104240260 ATGTTACTTTACATGGTAAAAGG - Intronic
1045651731 8:104347818-104347840 ATATTACCTCGCATGGTAAAAGG + Intronic
1045661373 8:104441411-104441433 ATGTTACTTTACATGGCAAAGGG + Intronic
1045682444 8:104677167-104677189 ATGTTAGGTTACATGGCAAAGGG + Intronic
1045860970 8:106814756-106814778 ATGTTACCTTACATGGGAAAAGG - Intergenic
1045912860 8:107430553-107430575 ATGTTACCTTACATGGTAAAAGG + Intronic
1046019589 8:108648483-108648505 ATGTTATTTTACATGGCAAAAGG + Intronic
1046118299 8:109811713-109811735 ATGCAGACTCACATGGGAGAAGG + Intergenic
1046275244 8:111950524-111950546 ATGTTTCCTTACATGGCAAAAGG + Intergenic
1046397422 8:113658300-113658322 ATGTTAAATTATATGTGAAAAGG + Intergenic
1046680072 8:117158885-117158907 ATGTTAAATCATATGGCAAAAGG + Intronic
1046806586 8:118486022-118486044 ATGTTACTTTGCATGGGAAAAGG + Intronic
1047002458 8:120586650-120586672 GTGTTGACTTACCTGGGAAAGGG - Intronic
1047023742 8:120805279-120805301 ATGTTAACTTACGTGGCAAAGGG + Intronic
1047065162 8:121273757-121273779 ATGTTTTCTTACATGGCAAAAGG - Intergenic
1047120828 8:121902682-121902704 ATGTTACCTGACATAGCAAAAGG + Intergenic
1047572201 8:126111240-126111262 ATGTTATATTACATGGCAAAGGG - Intergenic
1047661290 8:127039787-127039809 ATTTTAACTTTCATGGCAAAAGG - Intergenic
1047960807 8:130010431-130010453 ATTTTAACACACAAGGGAACTGG - Intronic
1048230313 8:132633638-132633660 ATGTTACCTTACATGGCAAAAGG + Intronic
1048257221 8:132914174-132914196 ATGTTAGGTTACATGGCAAAGGG - Intronic
1048323507 8:133420963-133420985 ATGTTACTTTACATGGAAAAGGG + Intergenic
1048370783 8:133774316-133774338 ATGTTATTTCACATGGCAAAGGG + Intergenic
1048555836 8:135475168-135475190 ATGTTAAGTCGCATGTCAAAGGG - Intronic
1048556059 8:135477661-135477683 ATGTTACCTTACATGGTAAAAGG + Intronic
1048807112 8:138251028-138251050 ATGTGAGCTCACGTGAGAAATGG + Intronic
1049003605 8:139841306-139841328 ATGGTACCTTACATGGCAAAAGG - Intronic
1049270652 8:141693907-141693929 ATGTTCCCTTATATGGGAAAAGG + Intergenic
1050027637 9:1352214-1352236 CTTTTAAATCAAATGGGAAAGGG + Intergenic
1050055215 9:1645634-1645656 ATGTTACTTTACATGGTAAAAGG + Intergenic
1050108350 9:2189123-2189145 ATGTTATATTACATGGCAAAAGG - Intronic
1050344170 9:4669802-4669824 ATGTTACCTTACATGGTAAAGGG - Intergenic
1050429830 9:5551120-5551142 ATGTCACCTTACATGGCAAAAGG - Intronic
1050746934 9:8887064-8887086 CAGTTAACTCACATGTAAAATGG - Intronic
1051104836 9:13567483-13567505 ATATTCACTGACATGGGAAAGGG - Intergenic
1051111156 9:13638266-13638288 ATGTTACCTTACATAGCAAAAGG - Intergenic
1051301712 9:15658513-15658535 ATGTTACCTTACATGGCAAATGG + Intronic
1051330874 9:16023878-16023900 ATGTTACCTTACATGGCAAAAGG + Intronic
1051599602 9:18859459-18859481 ATGCTACCTCACATGACAAAAGG - Intronic
1052509412 9:29396333-29396355 ATGTTAGCTTATATGGCAAAAGG - Intergenic
1052708393 9:32021415-32021437 ATGTTATCTTACATGGAAAAAGG - Intergenic
1052832566 9:33228258-33228280 ATGTTACCTCACATGACAAAAGG - Intronic
1053063319 9:35048159-35048181 ATATTATTTCACATGGAAAAAGG - Intergenic
1053294971 9:36906202-36906224 ATGTGACCTTACATGGCAAAAGG + Intronic
1053445348 9:38148934-38148956 ATGTTACTTTACATGGCAAAAGG + Intergenic
1053531710 9:38888697-38888719 ATGTTACCTGACATGGCCAAGGG + Intergenic
1053594785 9:39548781-39548803 ATGTGAACTTACATGAAAAATGG + Intergenic
1053852569 9:42303814-42303836 ATGTGAACTTACATGAAAAATGG + Intergenic
1054203934 9:62113125-62113147 ATGTTACCTGACATGGCCAAGGG + Intergenic
1054571469 9:66816186-66816208 ATGTGAACTTACATGAAAAATGG - Intergenic
1054634428 9:67475240-67475262 ATGTTACCTGACATGGCCAAGGG - Intergenic
1054754251 9:68941243-68941265 ATGTTACCTTATATGGCAAAAGG + Intronic
1054862426 9:69967569-69967591 ATGTTACCTTATATGGTAAAAGG - Intergenic
1054919233 9:70525252-70525274 ATGTTACCTTATATGGCAAAAGG - Intergenic
1054960328 9:70961019-70961041 ATGTTATCTTACATGGCAAGAGG + Intronic
1055501850 9:76909182-76909204 ATGTTAGGTTACATGGCAAAGGG - Intergenic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1055567985 9:77588176-77588198 ATGTTACTTGACATGGCAAAAGG - Intronic
1055685174 9:78765788-78765810 GTGCAAACTCACATGGCAAAGGG - Intergenic
1055851504 9:80636358-80636380 ACTTTATCTCACCTGGGAAAAGG - Intergenic
1055857228 9:80703793-80703815 ATGTTAACAAACATGGCCAAGGG - Intergenic
1056062742 9:82900847-82900869 ATGATAACTTCCATGGCAAAGGG - Intergenic
1056067396 9:82951122-82951144 ATTCTAAGTCACATGGCAAAAGG - Intergenic
1056337100 9:85582898-85582920 ATGTTACTTTACATGGCAAAAGG + Intronic
1056389885 9:86131316-86131338 ATGTTATTTTACATGGCAAAAGG - Intergenic
1057223554 9:93271388-93271410 ATGTTAACTTGCATGGAAAAAGG + Intronic
1057347373 9:94262310-94262332 ATAGAAACTCAGATGGGAAAAGG + Intronic
1057533297 9:95874497-95874519 ATATTAGCTTACATGGCAAAAGG + Intergenic
1057865383 9:98676024-98676046 ATGTTACCTTGCATGGCAAAAGG + Intronic
1057945216 9:99321729-99321751 ATGTTACTTTACATGGCAAAAGG - Intergenic
1057978815 9:99636902-99636924 ATGTCACCTTACATGGCAAAAGG - Intergenic
1058135992 9:101308144-101308166 ATGTTACCTTACATGGCAAAAGG + Intronic
1058255043 9:102751312-102751334 ATGTTACTTTACATGGAAAAGGG + Intergenic
1058442008 9:105018076-105018098 ATGTTACCTTACATGGAAAAAGG - Intergenic
1058573580 9:106375112-106375134 GTGTTAAGTCACATGGCAAAAGG - Intergenic
1058577111 9:106415586-106415608 ATGTTACCTTACATGGCAAAAGG + Intergenic
1058967423 9:110050000-110050022 ATGCTACCCCACACGGGAAACGG - Intronic
1059502683 9:114768480-114768502 TTGTGACCTCACATGGTAAAAGG - Intergenic
1059977383 9:119731896-119731918 ATGTTACCTTGAATGGGAAAGGG + Intergenic
1060012229 9:120053858-120053880 ATGTTACATTACATGGCAAAGGG - Intergenic
1060144880 9:121243402-121243424 ATGTTAGCTTATATGGCAAAAGG - Intronic
1060204021 9:121671442-121671464 ATGTTGCCTTACATGGCAAAAGG - Intronic
1060205615 9:121681097-121681119 CTGTTTCCTCACCTGGGAAATGG - Intronic
1060541015 9:124430164-124430186 ATGTTACCTTACATGATAAAAGG + Intergenic
1062263035 9:135672316-135672338 ATGTCACCTCATATGGCAAAGGG - Intergenic
1185787434 X:2902616-2902638 ATGTTAGCTAACATGGCAAAAGG + Intergenic
1186002317 X:5026557-5026579 ATGTTACCTAACATGGCAAAAGG + Intergenic
1186304169 X:8236300-8236322 ATATTAGCTTACATGGCAAAAGG - Intergenic
1186331601 X:8540640-8540662 ATGTTAAATCACCTGCAAAATGG - Intronic
1186365961 X:8893584-8893606 ATGTTACCTTACATGGCAAAAGG - Intergenic
1186420972 X:9426112-9426134 ATGTTACTTTACATGGCAAAGGG + Intergenic
1186526059 X:10249410-10249432 ATGTTACCCTACATGGCAAAAGG + Intergenic
1186594027 X:10961107-10961129 ATGTTACCTTACATGGCAAAAGG + Intergenic
1186622864 X:11259922-11259944 ATGTTATTTTACATGGTAAAAGG + Intronic
1186624481 X:11278207-11278229 GTGTTACCTTACATGGCAAAAGG + Intronic
1186698865 X:12067909-12067931 ATGTTACCTCATATGCCAAAGGG + Intergenic
1186823633 X:13315979-13316001 ATATTCACTAACATGGGAAGCGG - Intergenic
1186988317 X:15040231-15040253 ATGTTACCTTATATGAGAAAAGG + Intergenic
1187077363 X:15948418-15948440 ATGTGACCTTACATGGCAAAAGG - Intergenic
1187164341 X:16790820-16790842 ATGTTAACTCACTTGCCTAAGGG + Intronic
1187295887 X:18000096-18000118 CTGTTACCTTACATGGCAAAAGG - Intergenic
1187410185 X:19044453-19044475 ATGTTACCTTACATAGCAAAGGG - Intronic
1187536793 X:20148294-20148316 ATGTTATCTCACATGGCAACAGG + Intergenic
1187779352 X:22800474-22800496 ATGCAAAGTCACATGGCAAAGGG - Intergenic
1188072810 X:25737660-25737682 ATGTGAACCCACATGGCCAAGGG + Intergenic
1188324023 X:28777370-28777392 ATGTTACCTTACATGTCAAAAGG - Intronic
1188355245 X:29182763-29182785 ATGTTAGCATACATGGCAAAAGG + Intronic
1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG + Intergenic
1188584165 X:31752179-31752201 ATGTTACCTTACATGGCAAAAGG - Intronic
1189013903 X:37076411-37076433 ATGTTAGCTTACATGGGCATGGG + Intergenic
1189020796 X:37336821-37336843 ATATTATCTAACATGGAAAAAGG + Intergenic
1189097693 X:38157638-38157660 ATGTTACCTTACATGAAAAAAGG - Intronic
1189457367 X:41205122-41205144 ATGATAACTAATATGTGAAATGG + Intronic
1189532692 X:41902573-41902595 ATGTTACTTTACATGGTAAAAGG - Intronic
1189561183 X:42192920-42192942 ATGTTACCTTACAAGGCAAAAGG + Intergenic
1189595423 X:42559878-42559900 ATGTTACCTTACATGGCAGAAGG - Intergenic
1189705182 X:43752441-43752463 ATGTTACCTTACATGGCAAAGGG - Intergenic
1189800198 X:44684831-44684853 ATATTATCTTACATGGCAAAAGG + Intergenic
1189994843 X:46628525-46628547 ATATTAGCTCATGTGGGAAAAGG - Intronic
1190577229 X:51852339-51852361 ATGTTACCTTACATGGCAAATGG - Intronic
1191677661 X:63808597-63808619 ATGTTAGGTTACATGGCAAAAGG + Intergenic
1192495570 X:71614790-71614812 ATGTTACCTTAGATGGCAAAAGG - Intergenic
1192743898 X:73919799-73919821 ATGCTTATTCACATGGGGAAGGG - Intergenic
1192820852 X:74643490-74643512 ATGTTAGCTTACATTGTAAAGGG - Intergenic
1193331956 X:80244819-80244841 ATGTTACTTTACATGGCAAAAGG + Intergenic
1194300938 X:92185056-92185078 ATGTTAAATTACATAGCAAAAGG - Intronic
1194355002 X:92871988-92872010 ATGTTACCTTACATAGCAAAAGG - Intergenic
1194408359 X:93526497-93526519 ATGTTGCCTTACATGGAAAAAGG + Intergenic
1194454954 X:94092270-94092292 ATCTTACCTTACATGGCAAACGG + Intergenic
1194463372 X:94200447-94200469 ATGTTCACTCACATTGGGGAAGG + Intergenic
1194475006 X:94347684-94347706 ATGTTATCTCATTTGGAAAAGGG - Intergenic
1194754907 X:97727436-97727458 ATATTACCTTACATGGCAAAAGG + Intergenic
1194812161 X:98399953-98399975 ATGTTACATTACATGGCAAATGG + Intergenic
1194915991 X:99709327-99709349 ATGTTACATTACATGGCAAAAGG - Intergenic
1195098636 X:101531286-101531308 ATGTTACCTCATATAGCAAAAGG - Intronic
1195386823 X:104321499-104321521 AAGTTCACTCACATGGCCAATGG - Intergenic
1196083801 X:111661892-111661914 ATGTTACCTGACATGGTAAAAGG + Intergenic
1196138645 X:112236803-112236825 ATGTTACCTTACATGGCAAAAGG + Intergenic
1196227298 X:113180959-113180981 ATCTTAACTCACATAGGTAAAGG + Intergenic
1196284896 X:113868073-113868095 ATGTTATCTTACATAGCAAAAGG + Intergenic
1196641527 X:118068470-118068492 AGGTTATCTCACATGGGGGATGG - Intronic
1196804075 X:119569327-119569349 ATGTTACCTTACATGGCAAAAGG - Intergenic
1197116214 X:122836767-122836789 ATGTTACCCTACATGGCAAAAGG + Intergenic
1197134757 X:123048227-123048249 ATATTACTTCACATGGAAAAGGG + Intergenic
1197201367 X:123751657-123751679 ATGTTAGGTTACATGGCAAAGGG + Intergenic
1197312540 X:124923566-124923588 ATGTTAGGTTACATGGCAAAGGG + Intronic
1197853450 X:130889476-130889498 ATGTTAAGCCAATTGGGAAAAGG + Intronic
1198263084 X:134983878-134983900 CTGTTTCCTCACATGGCAAAAGG - Intergenic
1198680578 X:139177715-139177737 ATGTTCACTCCCCTGGAAAAGGG - Intronic
1198910717 X:141610494-141610516 ATATTACCTTACATGGTAAAAGG - Intronic
1199054063 X:143271558-143271580 ATGCTACCTTACATGGCAAAAGG - Intergenic
1200663362 Y:5989003-5989025 ATGTTACCTTACATAGCAAAAGG - Intergenic
1201225098 Y:11810968-11810990 ATGTTATCTTACATGGCAAAGGG - Intergenic
1201316834 Y:12655678-12655700 ATATTTCCTCACATGGCAAAAGG - Intergenic
1201431014 Y:13901970-13901992 ATGTTAAATCACCTGCAAAATGG + Intergenic