ID: 1131641945

View in Genome Browser
Species Human (GRCh38)
Location 15:94302350-94302372
Sequence CTTTCTTTGCTGATGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 275}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131641945_1131641948 1 Left 1131641945 15:94302350-94302372 CCCACCAGCATCAGCAAAGAAAG 0: 1
1: 0
2: 0
3: 33
4: 275
Right 1131641948 15:94302374-94302396 GAAATGTTAGTCTACTGTTATGG 0: 1
1: 0
2: 0
3: 2
4: 118
1131641945_1131641953 18 Left 1131641945 15:94302350-94302372 CCCACCAGCATCAGCAAAGAAAG 0: 1
1: 0
2: 0
3: 33
4: 275
Right 1131641953 15:94302391-94302413 TTATGGGGAATTGGAATGATGGG 0: 1
1: 0
2: 1
3: 16
4: 149
1131641945_1131641951 9 Left 1131641945 15:94302350-94302372 CCCACCAGCATCAGCAAAGAAAG 0: 1
1: 0
2: 0
3: 33
4: 275
Right 1131641951 15:94302382-94302404 AGTCTACTGTTATGGGGAATTGG 0: 1
1: 0
2: 1
3: 8
4: 108
1131641945_1131641952 17 Left 1131641945 15:94302350-94302372 CCCACCAGCATCAGCAAAGAAAG 0: 1
1: 0
2: 0
3: 33
4: 275
Right 1131641952 15:94302390-94302412 GTTATGGGGAATTGGAATGATGG 0: 1
1: 0
2: 1
3: 24
4: 296
1131641945_1131641954 19 Left 1131641945 15:94302350-94302372 CCCACCAGCATCAGCAAAGAAAG 0: 1
1: 0
2: 0
3: 33
4: 275
Right 1131641954 15:94302392-94302414 TATGGGGAATTGGAATGATGGGG 0: 1
1: 0
2: 3
3: 20
4: 233
1131641945_1131641950 3 Left 1131641945 15:94302350-94302372 CCCACCAGCATCAGCAAAGAAAG 0: 1
1: 0
2: 0
3: 33
4: 275
Right 1131641950 15:94302376-94302398 AATGTTAGTCTACTGTTATGGGG 0: 1
1: 0
2: 0
3: 8
4: 118
1131641945_1131641949 2 Left 1131641945 15:94302350-94302372 CCCACCAGCATCAGCAAAGAAAG 0: 1
1: 0
2: 0
3: 33
4: 275
Right 1131641949 15:94302375-94302397 AAATGTTAGTCTACTGTTATGGG 0: 1
1: 0
2: 2
3: 10
4: 136
1131641945_1131641955 28 Left 1131641945 15:94302350-94302372 CCCACCAGCATCAGCAAAGAAAG 0: 1
1: 0
2: 0
3: 33
4: 275
Right 1131641955 15:94302401-94302423 TTGGAATGATGGGGCAAAAGAGG 0: 1
1: 0
2: 1
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131641945 Original CRISPR CTTTCTTTGCTGATGCTGGT GGG (reversed) Intronic
900615108 1:3562000-3562022 CATTCTTTGGCGGTGCTGGTGGG + Intronic
901325340 1:8361924-8361946 ATTTCCTTGCTGAGGCTGATGGG - Intronic
904097994 1:27996784-27996806 CTTTCTTAGCTAAGGCTAGTGGG + Intronic
904695835 1:32330806-32330828 CTGCCTATGCTGATGCTGGGAGG + Exonic
904739024 1:32657781-32657803 TTTTCTCAGCTGGTGCTGGTGGG + Intronic
905493567 1:38364678-38364700 CATTCTTTGTAGATGCTTGTAGG - Intergenic
908404105 1:63797090-63797112 CTTTCTTACTTGAAGCTGGTGGG + Intronic
908626644 1:66051938-66051960 CTTTCATAGCTGATGAAGGTTGG + Intronic
909375767 1:74939964-74939986 CATTTTTTGCTGATGCAGGTGGG - Intergenic
909696421 1:78473324-78473346 ATTTCATTGCTTATGCTGGGAGG + Intronic
910746343 1:90579079-90579101 GTTTCATTGCTGCTGCTGGAAGG - Intergenic
911552202 1:99296726-99296748 CTATCTTTGCAGATTATGGTAGG + Exonic
912872007 1:113316170-113316192 CTTTCGTTGCCTATGCTTGTGGG - Intergenic
915001134 1:152592980-152593002 CTTTTTTTGCTGATGTAAGTGGG + Intronic
915119393 1:153619217-153619239 CTTTCTCTGCTGGTGCTCCTTGG - Intronic
915868898 1:159536705-159536727 TTTTTTTTGCTGATTCTAGTAGG + Intergenic
915958117 1:160240229-160240251 CTTTCTGTGCTGGTGCGGTTGGG + Exonic
916006460 1:160665607-160665629 CTTTCTTTGTTGATACTACTGGG - Intergenic
916184749 1:162119987-162120009 ATGTCTTTGGTGCTGCTGGTGGG + Intronic
916214687 1:162384877-162384899 TCTTTTATGCTGATGCTGGTGGG + Intronic
917198076 1:172487474-172487496 CTTCCTTTGCTGATCCTTATAGG - Intergenic
917509110 1:175655680-175655702 GTTTCTTTGCTAATGGTGGTGGG - Intronic
918530055 1:185509387-185509409 CTTTCTTAGCTAATACTGGGTGG - Intergenic
920934459 1:210418219-210418241 CCTTCTTTGCTGGTGGTGGCTGG + Exonic
921237399 1:213147223-213147245 CTTTGATTGCTGGTGCTTGTGGG + Intronic
921917285 1:220626884-220626906 CTGCCTATGCTGATGCTGGGAGG + Intronic
922621721 1:226994071-226994093 CTGTCTTTGTTGTTGCTGTTAGG + Exonic
924365389 1:243287932-243287954 TTTTCTTTGCTCATGCTGCAAGG - Intronic
1063727242 10:8651373-8651395 CTTTGTCTGCAGATGATGGTAGG - Intergenic
1064897475 10:20254349-20254371 CTTGCTTTGCAGCTGCTGGATGG + Intronic
1067188594 10:44051104-44051126 GTTTCTTTGTTGTTGCAGGTTGG - Intergenic
1067654690 10:48182554-48182576 GTTTCCTTGGTGATGCTGGCTGG - Intronic
1067823198 10:49549159-49549181 CATTCTTTGCTGATGGCTGTGGG - Intergenic
1068764329 10:60746426-60746448 CTTTGTTTGGAGGTGCTGGTGGG + Intergenic
1068775245 10:60861932-60861954 CTTTCCTTGCTGCAGCTGGCAGG + Intergenic
1069335951 10:67350599-67350621 TTTTCTTTGTTGTTGGTGGTGGG - Intronic
1069773934 10:70916047-70916069 CTTTCCTTGCTGAGGCTTCTGGG + Intergenic
1070648811 10:78220369-78220391 CTGTCTTTGTTGGTGCTGGAAGG - Intergenic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1076678998 10:132161848-132161870 TTTTCTTGGGTGATGCTGGGGGG + Intronic
1077932457 11:6748280-6748302 TTTTCTTTTCTGAATCTGGTTGG - Intergenic
1078741197 11:14067722-14067744 CCTTCCTTGCTGCTGGTGGTAGG - Intronic
1079704153 11:23592383-23592405 CTGTCTCTTCTGATTCTGGTAGG + Intergenic
1079966473 11:26986228-26986250 CCTTCTTTGCACATGCTGGTAGG + Intergenic
1080346283 11:31329357-31329379 CTTTCTTTGCTTAAGCTAGTTGG + Intronic
1080943106 11:36941297-36941319 GTTTCTTTGCTTCTGCTGGGAGG - Intergenic
1081714909 11:45243073-45243095 GTCACTTTGGTGATGCTGGTGGG + Exonic
1082947183 11:58772871-58772893 CTTTCTTATCTGGTGCTGGGTGG - Intergenic
1083299954 11:61735093-61735115 CTTGCTTGGCTGGTGCTGGCTGG + Intronic
1085554749 11:77410316-77410338 CCATCTTTGCTGGTGGTGGTGGG - Intronic
1086990635 11:93300003-93300025 CTTTCCCTGCTAATGCTGTTAGG + Intergenic
1088729037 11:112664563-112664585 CCTTTTTTCCTGGTGCTGGTGGG - Intergenic
1089177946 11:116561754-116561776 CTTTCTTTGCAAAGGCTGGTTGG - Intergenic
1089707418 11:120289699-120289721 CTTTCTTTGCTTTTGCTGCCTGG + Intronic
1090064955 11:123494787-123494809 CCTTCTTCGCTGAGGCTGGTAGG - Intergenic
1090669019 11:128933236-128933258 CATTCTGTGCAGATGCTGGTTGG - Intergenic
1090960481 11:131552112-131552134 CTTTCCTTCCTCATTCTGGTGGG - Intronic
1091925881 12:4348335-4348357 GTTTCTTTACTTATCCTGGTTGG - Intronic
1092658947 12:10718426-10718448 CTTGCTTTGCTTTTGCTGGGAGG - Intronic
1092963432 12:13617984-13618006 CTTGTTTGGCTGATGCTGGTTGG + Intronic
1093810102 12:23482118-23482140 CTTTTTTTGCTTAAGCTGTTGGG - Intergenic
1094687587 12:32733764-32733786 CAGACTTTGCTGATGCTTGTGGG + Exonic
1097765809 12:63525463-63525485 CTTTCTTTTATGCTGCTGATAGG - Intergenic
1098094210 12:66937203-66937225 ATTTCTCTGCTGATCCTTGTTGG + Intergenic
1099898690 12:88681132-88681154 CTTTATTTGCTCATGCTTATAGG - Intergenic
1100656188 12:96648473-96648495 CTTTCTTGGAAGATGCTGGTTGG - Intronic
1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG + Intergenic
1102261159 12:111444333-111444355 CTTTCTTTGCTCTGGCTGCTAGG - Intronic
1104116379 12:125753065-125753087 CGTTCTTTTGTGATGGTGGTGGG + Intergenic
1105586541 13:21750376-21750398 CTTTCTCTGCCTGTGCTGGTGGG + Intergenic
1106983540 13:35318735-35318757 CTTTTTTTGTTGTTGTTGGTAGG + Intronic
1107178365 13:37426273-37426295 GTTTCTTTGTTGATTCTGTTTGG - Intergenic
1107307108 13:39034427-39034449 CTTTCTTTGTAGAAGTTGGTAGG - Intronic
1107558795 13:41542424-41542446 TGTTCTTTCCTGCTGCTGGTAGG + Intergenic
1109377478 13:61515825-61515847 CTTACTTTTCTGAAGCTAGTTGG - Intergenic
1109559901 13:64033115-64033137 CTTTCTTGGCTTTTGCTGGTAGG - Intergenic
1113041101 13:106104557-106104579 CATTCTTTTCTGGTCCTGGTAGG - Intergenic
1115582373 14:34774071-34774093 CCTTCTCTGCTGAGTCTGGTTGG - Intronic
1117296793 14:54387550-54387572 TTCTCTTTGCTGATGTTGCTTGG + Intergenic
1117315274 14:54566529-54566551 CTTTCTTTGCTGTCGTTGGGGGG + Intergenic
1118118357 14:62806872-62806894 CTCTCTTTGCTGATGGCTGTGGG + Intronic
1118812306 14:69284286-69284308 CTCTCCTTGCTGCTGCTGATGGG - Intronic
1119468694 14:74880099-74880121 CTTTCATTGCTTCTCCTGGTCGG - Intergenic
1120477235 14:85003916-85003938 TTTTCTTTGCTGACTCTGGCTGG - Intergenic
1122453252 14:101829084-101829106 CTTTTATTGCTGAGTCTGGTTGG + Intronic
1122535068 14:102456204-102456226 CTTTGTTAGCTGCTGGTGGTGGG + Intronic
1122861786 14:104585893-104585915 CTTTTTGGGCTGGTGCTGGTGGG - Intronic
1124110724 15:26783126-26783148 CTTTCTTTTCTGATATTAGTAGG + Intronic
1125241819 15:37584941-37584963 ATTTGTTTGATGATACTGGTGGG - Intergenic
1126850425 15:52793564-52793586 TTTTCTTTGCTGAACCTGGTAGG - Intergenic
1127218765 15:56854424-56854446 TTTTCTTTGTTGATGCTCTTTGG - Intronic
1127440963 15:59007409-59007431 CCTTCTTTGTTGTTGCTGTTTGG + Intronic
1127578303 15:60313824-60313846 CTTTGTCTCCTGATGCTAGTGGG - Intergenic
1128916714 15:71569648-71569670 CTTTCTTTGCTTTGGCTGCTAGG - Intronic
1129466786 15:75728568-75728590 CTGGCTTTGCTGCTGCTGGGCGG + Intergenic
1129720459 15:77875210-77875232 CTTGCTTTGCTGCTGCTGGGTGG - Intergenic
1130773074 15:86944423-86944445 CTTTCCCTGCACATGCTGGTCGG - Intronic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1131723483 15:95197105-95197127 CTTTGTTTGCAAATGCTGGGAGG - Intergenic
1131796953 15:96028935-96028957 CTTTCTTTGCTAATGCTACAAGG - Intergenic
1132591989 16:730106-730128 CTGCCCTTGCTGCTGCTGGTCGG - Exonic
1134393080 16:13837877-13837899 CATTATTTTCTGATGCTGGTCGG - Intergenic
1134656652 16:15952614-15952636 CTTTCTTTTCTCATGGGGGTGGG + Intronic
1136576346 16:31127518-31127540 CTGGCTTTGCTGTTGCTGGCAGG + Intronic
1137540098 16:49356149-49356171 CTCTCTTTGCTGGGGCTGGCTGG - Intergenic
1138952137 16:61925876-61925898 CTTTCTGACCTGATCCTGGTTGG - Intronic
1139660534 16:68417629-68417651 CTTTCTTTGCTTTGGCTGCTAGG + Intronic
1139945601 16:70639534-70639556 CACTCTTTGCTGATGTTGGCAGG - Intronic
1140578446 16:76200258-76200280 CTGTACTTGCTGATACTGGTTGG + Intergenic
1140809843 16:78566553-78566575 CTGTCTGTGCTGAGGCTGGGAGG + Intronic
1142721942 17:1782256-1782278 CCTTCTTTGCTGGGGTTGGTGGG + Intronic
1144816333 17:18038256-18038278 CTTTCATTGCTGATGGTGAGTGG - Intronic
1145118022 17:20229917-20229939 CCTTCTTGGCTAGTGCTGGTTGG + Intronic
1145170212 17:20649822-20649844 CCTTCTTGGCTAGTGCTGGTCGG + Intergenic
1145222024 17:21097280-21097302 CTTTTTTTGCTGGTGGTGGAAGG + Intergenic
1145267308 17:21386008-21386030 CTTTCTTTACTGGACCTGGTTGG - Intronic
1147253376 17:39166603-39166625 CTTTCTTTGCTTAAGCTGGGGGG + Intronic
1147413610 17:40272331-40272353 TTTTCATTGGTGATGGTGGTGGG + Intronic
1147485545 17:40809187-40809209 GTTTCTTTGCTGTTTCTGGTGGG - Intergenic
1155065739 18:22267478-22267500 CTTTCTTGGCTGTTCCCGGTTGG + Intergenic
1156459830 18:37315495-37315517 CGGTCTTTGATGATGCTGGCTGG - Intronic
1158231136 18:55256746-55256768 CTTTCTCTCCTCATGATGGTGGG - Intronic
1158948586 18:62469832-62469854 CTTTGGTTGCTTATGCTTGTGGG + Intergenic
1159621063 18:70638917-70638939 CTTTGGTTGCTTATGCTTGTGGG + Intronic
1159724606 18:71940818-71940840 CTTTCTTTTCTAGTGCTTGTTGG + Intergenic
1161066246 19:2239560-2239582 TTTTATTTGCTGATCCTGGTGGG + Intronic
1161958872 19:7512009-7512031 CTTCCTTTGCTGTTGCTTGGAGG - Intronic
1162614808 19:11790098-11790120 CTTTCATTGCCTATGCTTGTGGG - Intergenic
1165704217 19:37963726-37963748 CTTTCATTGTTGATTTTGGTGGG + Intronic
1168651711 19:58096385-58096407 CTTCATTTGCTGAGGCTGGGGGG - Intronic
928776453 2:34769977-34769999 CTTTGGTTGCTTATGCTTGTGGG + Intergenic
929153665 2:38770723-38770745 CTTTTTTTGGTGGTGGTGGTGGG + Intronic
929497001 2:42453737-42453759 CTTTGGTTGCCTATGCTGGTGGG + Intronic
929535712 2:42783133-42783155 CTTTGTTGGCTGATGGTGGAGGG - Intronic
931025537 2:58109977-58109999 CTTTGCTTCCTGATGCTTGTAGG - Intronic
931842065 2:66163053-66163075 CTTTCATTCCTGATATTGGTTGG - Intergenic
931949276 2:67343628-67343650 CTTTTTTTTTTGATGGTGGTGGG - Intergenic
933813920 2:86050822-86050844 CTTTCTTTGGTTATCCTGGAAGG + Intronic
935516914 2:104051684-104051706 AATTCTTTGGTGATTCTGGTGGG - Intergenic
937029496 2:118726381-118726403 ATTTCTTTGCTGTGGCTGGTGGG + Intergenic
938151365 2:128887696-128887718 CTTTCATTCCTGATTTTGGTAGG + Intergenic
940499339 2:154474939-154474961 CACTCTTTGCTGATGGTTGTGGG - Intergenic
944218654 2:197280300-197280322 CTTTCTTTGTTGTTTCTGGTAGG - Intronic
945209253 2:207365247-207365269 CTATCTTTGCAGATGCTGAAGGG + Intergenic
947042422 2:225938559-225938581 CTTTCTTTTCTCATGCTAGTTGG + Intergenic
947915238 2:233828308-233828330 CTTTCTGTTCAGATGCAGGTGGG + Intronic
947985022 2:234440358-234440380 TTGTCTTTACTGATGCTGGTGGG + Intergenic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
1170858503 20:20080335-20080357 CTTTCTTTTCTGATGGTGCCTGG + Intronic
1173417949 20:42874920-42874942 CTTTCGTTGCTCAGGCTGGAGGG + Intronic
1174417684 20:50378306-50378328 CCTTCTTGGATGCTGCTGGTGGG - Intergenic
1174918851 20:54681084-54681106 CTTTGTTTAATGATGCTGGCTGG + Intergenic
1182714728 22:32348398-32348420 CCTTCTGTGCTGAGTCTGGTGGG + Intergenic
1183120826 22:35728844-35728866 CCTTTCTTGCTGGTGCTGGTGGG - Exonic
1184614344 22:45627835-45627857 CGGTCTTTGCTTATGCTGGGTGG + Intergenic
950918453 3:16668626-16668648 TTTTATTTGCTAATGCAGGTAGG - Intronic
951205270 3:19919641-19919663 CTGTCTTGGCTGCTGCTGCTTGG + Intronic
951874240 3:27403843-27403865 CTTTCTGTGGTGATAATGGTGGG - Intronic
952755727 3:36864883-36864905 CAGTCTTTGCTGATGTTGGCTGG - Intronic
954130375 3:48557504-48557526 CTTTCTTTGCTTTGGCTGCTGGG + Intronic
954148674 3:48646901-48646923 TTTTCTATGCTGCTGCTTGTGGG + Exonic
956904693 3:73753622-73753644 ATTTCTTTGCTCATGCATGTTGG - Intergenic
956962724 3:74421496-74421518 CTTTCTTTGCTTACTCTGTTAGG + Intronic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
960360252 3:116702492-116702514 CTGTCTCTGGGGATGCTGGTTGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
964259344 3:154817673-154817695 CTCTCTTTGCTGATGTTATTGGG - Intergenic
964347905 3:155772901-155772923 CTTTCTTGTTTGATGGTGGTGGG + Intronic
964367393 3:155964874-155964896 GTTTCTTTGTTGATGGTAGTTGG - Intergenic
965048700 3:163615583-163615605 CTTTCTTTCCTGTTACTTGTTGG - Intergenic
965318467 3:167221629-167221651 CTTTCATTGCTGGTGCTTGTGGG - Intergenic
965492580 3:169357624-169357646 CTTTTTTTGAGGATGCAGGTGGG - Intronic
965771131 3:172182139-172182161 CTTACCTTGCTGATTCTGGTAGG - Intronic
967731371 3:192909990-192910012 CTTTCTTTGCTTAGGCTCTTAGG - Intronic
967738351 3:192978314-192978336 CTTTGATTGCTGGTGCTTGTGGG - Intergenic
968045143 3:195619767-195619789 CTTTCTATGGTGCTGTTGGTGGG - Intergenic
970424497 4:15933805-15933827 CTTTCTTTGCTGTGGCTTGAAGG + Intergenic
970450431 4:16161400-16161422 ATTCCTTTGCAGATGCTGTTGGG - Exonic
970592456 4:17571328-17571350 CACTCTTTGCAGAAGCTGGTGGG - Intergenic
972091185 4:35286310-35286332 CTTTATATTCTGATGCTGTTTGG + Intergenic
973985546 4:56348746-56348768 AGTTCTTTGCTGATTCTGGCAGG - Intronic
974051956 4:56950000-56950022 CATTCTTTGCTGATGGCTGTGGG - Intergenic
974860941 4:67520633-67520655 CTTCATTTTCTGATGCTGTTAGG - Intronic
975554383 4:75646140-75646162 CTTGCTTTGCTGAAGAAGGTGGG - Intronic
975845377 4:78519650-78519672 CCTTCTGTCCTGATGCTGGAAGG + Intronic
975961141 4:79906941-79906963 CTTTATTTGCTTAGCCTGGTGGG + Intronic
979502618 4:121457420-121457442 CTTTGTTTGCAAATGCTGTTGGG - Intergenic
979904646 4:126271488-126271510 CCTTCTTGGCTAATGCTGGCTGG - Intergenic
980390630 4:132141333-132141355 CTTGCTTAGCTCATTCTGGTTGG - Intergenic
981117054 4:141003929-141003951 CTTCCTCTCCTGATGCGGGTGGG - Intronic
981200978 4:141979167-141979189 CTTTCTTTTATGATGCGGCTTGG + Intergenic
982080156 4:151781747-151781769 CTTTGTTTGCTGAGGCTGGAGGG + Intergenic
982648128 4:158049597-158049619 CTTACTTTGTTGATGCTATTAGG - Intergenic
983444527 4:167833100-167833122 CTGTCTTTGCTGATGCTTCTGGG - Intergenic
984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG + Exonic
985682145 5:1261660-1261682 ATTTCTTTGACGCTGCTGGTAGG + Intronic
985767222 5:1786349-1786371 CTTTCTGTGCTGGTCCTGGGAGG - Intergenic
985991537 5:3565867-3565889 GTTTCTCTCCTGATGCTAGTGGG - Intergenic
987259858 5:16192546-16192568 CTTTCATTGCTGCTGCTGGCGGG + Intergenic
987531079 5:19120241-19120263 CTTTTTTTGCTTATGCTCATTGG - Intergenic
987921175 5:24283627-24283649 ATATCTTTGCTGGTGCTGTTGGG - Intergenic
988171721 5:27666208-27666230 CTGTCTTTGGTCATGATGGTGGG - Intergenic
988353318 5:30141232-30141254 CTTTCATTGCATATGCTTGTGGG + Intergenic
988601145 5:32640542-32640564 TTTTCTTTCCTTATGCTGGAGGG + Intergenic
990338553 5:54800211-54800233 CTTTCTCTGCTGATCATGTTGGG - Intergenic
990432544 5:55750676-55750698 CCTTCTGTGCTGATGCTGCCCGG - Intronic
990622176 5:57571550-57571572 CTTGCTTTGCTGAGGCTGGGTGG + Intergenic
990814311 5:59766406-59766428 CTTCCTTTTCTGGTGCTGTTTGG - Intronic
990828758 5:59932621-59932643 CTTTGGTTACTGATGATGGTGGG - Intronic
992131951 5:73702116-73702138 CTCTCTTGTATGATGCTGGTTGG - Intronic
992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG + Intergenic
992185686 5:74242131-74242153 CTTTCTTAGATCATGGTGGTGGG - Intergenic
992669902 5:79048935-79048957 ATTTCTTTGCTGAAACTTGTGGG - Intronic
993020109 5:82581847-82581869 CTTTTTTTGTTGTTGTTGGTTGG + Intergenic
993276875 5:85871298-85871320 AGTTATTTGATGATGCTGGTGGG - Intergenic
994113354 5:96033763-96033785 CTTTTGTTGCTGATGCTTTTGGG - Intergenic
994301680 5:98155314-98155336 CTTTGTCAGCTGATGCTGTTGGG - Intergenic
994603852 5:101942576-101942598 TTTTCTTTCCTGTTGCTGTTAGG + Intergenic
995196430 5:109374654-109374676 CTTACTTTGTTGATGATGTTGGG - Intronic
995204947 5:109469069-109469091 CTTTCTTTTTTAATGCTGGTTGG - Intergenic
996241150 5:121203844-121203866 CTTTCTCTGCTGAGGCAGATTGG - Intergenic
996912287 5:128669579-128669601 CCTTATTTGCTTATGATGGTAGG + Intronic
997348242 5:133209614-133209636 CTTTCTTGGCTGATGGGGGAAGG + Intronic
998150260 5:139753087-139753109 CTGAGTTTGCTGATGGTGGTGGG - Intergenic
998224759 5:140318380-140318402 CTCTCTTTGCTGAAGGGGGTGGG - Intergenic
998297331 5:140984283-140984305 CTCCCATTGGTGATGCTGGTTGG + Intronic
1000156959 5:158561717-158561739 CTTTGATTAATGATGCTGGTGGG - Intergenic
1000167105 5:158661108-158661130 TTTTCTTTACTGATGCTATTTGG - Intergenic
1001222252 5:169911027-169911049 CTACCTTTGCTGATGCTCGTTGG + Intronic
1001782722 5:174384290-174384312 CTTTCTTTGTGGATGTTTGTAGG + Intergenic
1001922934 5:175614887-175614909 CTTTCTTTGCATGTGCTTGTTGG - Intergenic
1002767201 6:252451-252473 TTTTTGTTGCTGATGGTGGTTGG - Intergenic
1004513206 6:16299261-16299283 CTTTCTTTGATGGTGCTTGCAGG - Exonic
1006893331 6:37448603-37448625 TTGTCTCTGTTGATGCTGGTTGG + Intronic
1006931951 6:37693989-37694011 GTGTCTCTGCTGAGGCTGGTAGG - Intronic
1007874452 6:45079911-45079933 CTTTGATTGCCTATGCTGGTGGG - Intronic
1008320302 6:50103975-50103997 CTTTCTTTGCTTGTGCTTCTTGG - Intergenic
1008546425 6:52587798-52587820 GATTCTTTGCTGATGATGTTGGG + Intergenic
1009527832 6:64768918-64768940 CTTACATTGATGATGCTGGCAGG + Intronic
1010303757 6:74291813-74291835 CTTTGTTTGCCTATGCTTGTGGG + Intergenic
1011846234 6:91566349-91566371 CTATCTTTGCTGAAGCTCTTTGG - Intergenic
1015627604 6:135197046-135197068 CTCTCTTTGCTGAAGCTGTAGGG - Exonic
1016044691 6:139468599-139468621 TCTTCTTTGCTGTTGTTGGTTGG + Intergenic
1016469230 6:144357749-144357771 ATTTATTTGCTGATATTGGTTGG + Intronic
1016612401 6:146006047-146006069 CTTTAGTTGCTTATGCTTGTGGG - Intergenic
1017010115 6:150057810-150057832 CTTGCTTTGAGGGTGCTGGTGGG + Intergenic
1017942462 6:159065114-159065136 CTTCCTTTGCAGATGCTGTCTGG - Intergenic
1018252144 6:161881879-161881901 TTCTCTTTTCTGATGCTGATAGG + Intronic
1018455961 6:163952341-163952363 CTTTCTGTGCTGCTGCTGGAAGG - Intergenic
1020517606 7:9142725-9142747 CTTTCTCTTCTGATGAGGGTTGG + Intergenic
1021376231 7:19910505-19910527 CTTTCATTGCTTGTGCTTGTAGG - Intergenic
1021907145 7:25345760-25345782 GTTTGTTTGCTGATTCTGGATGG + Intergenic
1025252962 7:57364244-57364266 CCCTCTTGGCTGCTGCTGGTGGG + Intergenic
1026328582 7:69332696-69332718 CTTTTTTTGATGCTGCTGGCAGG - Intergenic
1028176491 7:87666250-87666272 CTTTCTTTTCATATGCTTGTGGG + Intronic
1028413420 7:90555326-90555348 CTTTCTACGCTGATGATAGTTGG - Intronic
1030735842 7:113047669-113047691 CTATCTATGGTGATGATGGTGGG - Intergenic
1031465839 7:122110272-122110294 CTCTTTTTCCTGATGTTGGTTGG - Intronic
1034210760 7:149359980-149360002 TTTGCTTTGCAGATACTGGTGGG + Intergenic
1036738759 8:11342704-11342726 CTTTCATTGCTTCTGCTGGAAGG + Intergenic
1038408384 8:27339781-27339803 TTTCCTTTACTGATGGTGGTTGG + Intronic
1040133646 8:43827143-43827165 CTTTCTTTGATTAAGCAGGTTGG + Intergenic
1040326534 8:46345552-46345574 CTTTCTTTGATTCAGCTGGTTGG + Intergenic
1041107404 8:54456857-54456879 GCTTCTTTGCTAATGCTGGAGGG + Intergenic
1042992797 8:74659472-74659494 ATTTTTTTGCTGAAGCTGGAGGG + Intronic
1043298114 8:78692459-78692481 CTTTCTTTGCTGGTAATGTTTGG + Intronic
1043391284 8:79794736-79794758 CTTTCTGTACTGAGGCTGGCTGG - Intergenic
1044260565 8:90114906-90114928 CTTTCTTGGCTTTTGCTGGCAGG + Intergenic
1045231525 8:100310665-100310687 CTGTCTTTGCAGAGGCTGTTAGG + Intronic
1047095940 8:121625890-121625912 ATTTATCTGATGATGCTGGTGGG - Intronic
1047208120 8:122819693-122819715 CTTTCTATGCCGATGCCTGTGGG - Intronic
1047400552 8:124542897-124542919 ATTTTTTTGCTGCTGCTGTTTGG + Intronic
1047934642 8:129764871-129764893 CTTTCTTCCCTGCTGCAGGTGGG + Intronic
1048032532 8:130646188-130646210 GTTTCCTTGATGATGCAGGTTGG - Intergenic
1048280388 8:133101429-133101451 CCTCCTTGGCTGATGGTGGTTGG - Intronic
1049602358 8:143513847-143513869 CAGCCTTTGCTGAGGCTGGTGGG + Intronic
1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG + Intergenic
1051532027 9:18114884-18114906 CTTTCTTTGCTGATGTTTTAAGG + Intergenic
1051948978 9:22607720-22607742 CTTTCTTTGGGGCTGCTGCTTGG - Intergenic
1052420736 9:28240754-28240776 CTTTCGTTGCTTATGCTTGTGGG - Intronic
1055904886 9:81281716-81281738 TTTTCTTTGGTGATGCATGTAGG - Intergenic
1056043079 9:82687762-82687784 CTTTCTCTGCTGATAAAGGTGGG + Intergenic
1056400042 9:86218072-86218094 CATCCTTTGATGATGATGGTAGG - Intergenic
1056728315 9:89142064-89142086 CATTCTTTGCTGATGGCTGTGGG - Intronic
1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG + Intergenic
1056990419 9:91405576-91405598 CTTCCTTTTCTCATGCAGGTTGG + Intergenic
1057391740 9:94646325-94646347 CCTTCCTTGCTGATGACGGTGGG - Intergenic
1058557947 9:106190450-106190472 CTTTGTTTGCCTATGCTTGTGGG + Intergenic
1061810241 9:133158164-133158186 CTTTTGTTGCTGCTGCTGGCTGG - Intronic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1187986455 X:24817952-24817974 TTTTTTTAGGTGATGCTGGTAGG + Intronic
1190815313 X:53924250-53924272 CATTCTTTGCTGATGCCTATGGG + Intergenic
1191023063 X:55883671-55883693 CTTTCTTTTCATATGCTTGTTGG - Intergenic
1192002699 X:67172261-67172283 CTTTTTTTGTTGATGGTGGTAGG + Intergenic
1192590312 X:72354190-72354212 CATTCTTTGCTGAAGCAGGCTGG + Intronic
1193176285 X:78398800-78398822 CTTTCTTTGCCTGTGCTTGTGGG - Intergenic
1193636704 X:83959309-83959331 CTTTCTATGCTGATTTTGCTGGG - Intergenic
1195984247 X:110612074-110612096 CTTTTTTTGTTGTTGTTGGTAGG - Intergenic
1196266899 X:113660355-113660377 CTTTTTTTGTTGTTGTTGGTAGG - Intergenic
1196488214 X:116238758-116238780 CTTACTTTGCTTATGTTGGCAGG + Intergenic
1197315429 X:124960087-124960109 CTTTCTTTTCTGATGCTTAAAGG + Intronic
1198498165 X:137214841-137214863 CATTCTTTGCTGATGGCTGTGGG + Intergenic
1199519937 X:148723927-148723949 TTTTTTTTGGTGATGATGGTGGG + Intronic
1202273161 Y:23089564-23089586 CTTTCTCAGCTGCTGCAGGTTGG - Intergenic
1202292865 Y:23331118-23331140 CTTTCTCAGCTGCTGCAGGTTGG + Intergenic
1202426158 Y:24723308-24723330 CTTTCTCAGCTGCTGCAGGTTGG - Intergenic
1202444631 Y:24946778-24946800 CTTTCTCAGCTGCTGCAGGTTGG + Intergenic