ID: 1131642483

View in Genome Browser
Species Human (GRCh38)
Location 15:94307427-94307449
Sequence AGGGACACTCCTGCTACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131642483_1131642488 -2 Left 1131642483 15:94307427-94307449 CCCAGGGTAGCAGGAGTGTCCCT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1131642488 15:94307448-94307470 CTGATGTTTCAGGAAGAGCAAGG 0: 1
1: 0
2: 1
3: 32
4: 328
1131642483_1131642489 9 Left 1131642483 15:94307427-94307449 CCCAGGGTAGCAGGAGTGTCCCT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1131642489 15:94307459-94307481 GGAAGAGCAAGGAAGCAGTGAGG 0: 1
1: 1
2: 3
3: 83
4: 749
1131642483_1131642490 13 Left 1131642483 15:94307427-94307449 CCCAGGGTAGCAGGAGTGTCCCT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1131642490 15:94307463-94307485 GAGCAAGGAAGCAGTGAGGCTGG 0: 1
1: 0
2: 11
3: 303
4: 1942
1131642483_1131642492 21 Left 1131642483 15:94307427-94307449 CCCAGGGTAGCAGGAGTGTCCCT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1131642492 15:94307471-94307493 AAGCAGTGAGGCTGGAGAGGAGG 0: 1
1: 2
2: 15
3: 132
4: 1185
1131642483_1131642491 18 Left 1131642483 15:94307427-94307449 CCCAGGGTAGCAGGAGTGTCCCT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1131642491 15:94307468-94307490 AGGAAGCAGTGAGGCTGGAGAGG 0: 1
1: 0
2: 16
3: 143
4: 1045
1131642483_1131642493 29 Left 1131642483 15:94307427-94307449 CCCAGGGTAGCAGGAGTGTCCCT 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1131642493 15:94307479-94307501 AGGCTGGAGAGGAGGCAGTGAGG 0: 1
1: 0
2: 12
3: 161
4: 1259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131642483 Original CRISPR AGGGACACTCCTGCTACCCT GGG (reversed) Intronic
901175262 1:7294175-7294197 AGGGAGCCTCCTGCCACCTTGGG - Intronic
903015318 1:20357916-20357938 AGGGACATTCCTGCTCCACCTGG - Intergenic
903121161 1:21217862-21217884 AGGGACACCCCTGCCACCTTGGG - Intronic
912688180 1:111783441-111783463 AAGGAGAATGCTGCTACCCTAGG + Intronic
912796042 1:112694224-112694246 AGAAACACTCCTCCTCCCCTGGG - Intronic
915031886 1:152886811-152886833 AGTGAGAGTCCTGCTACACTGGG + Intergenic
915870848 1:159557983-159558005 AGGAACCCTGCTGCTACCCAGGG - Intergenic
916712892 1:167427575-167427597 AGGGAGACTACTGCTACTCAGGG - Intergenic
919784918 1:201252919-201252941 AGGGACTCTCCTGCCTCCATGGG + Intergenic
921865105 1:220080582-220080604 AGGGACTCTCCCGCTTCGCTTGG - Intronic
1064024883 10:11840094-11840116 AGGTACACTCCTCCACCCCTGGG + Intronic
1066650319 10:37648995-37649017 TGGGGCACTTCTGCTACTCTGGG + Intergenic
1067033268 10:42894835-42894857 TGGGGCACTTCTGCTACTCTGGG + Intergenic
1067732487 10:48822039-48822061 AGGGGCCCTGCTGCTACACTAGG - Intronic
1069557540 10:69407802-69407824 AGGCACACTCCTGCTCCGTTTGG + Intronic
1069767317 10:70872487-70872509 ATGGCCACGCCTGCCACCCTTGG + Intronic
1069833554 10:71295126-71295148 GGGGACACTCCTTCTCCCATGGG - Intronic
1071680749 10:87703047-87703069 AGAGACACACATGCCACCCTGGG + Intronic
1072906001 10:99454453-99454475 AGGGAAACTCCTGCTTCCCAAGG - Intergenic
1078544623 11:12238188-12238210 AGGGACATTCCTGGTGTCCTTGG + Intronic
1078553150 11:12294128-12294150 AGGGGCTCTCCTGCTGCCCTAGG - Exonic
1084082583 11:66838294-66838316 AGGCACACTCCTGTTTCACTAGG + Intronic
1085319821 11:75567086-75567108 AGTGACAGTCCTGCCTCCCTGGG - Intronic
1086545711 11:87965388-87965410 GGGAACACTCCTGAAACCCTTGG + Intergenic
1087824854 11:102753655-102753677 ACGTTCCCTCCTGCTACCCTGGG - Intergenic
1089665240 11:120013955-120013977 AGGCCCACTCCGGCTGCCCTGGG - Intergenic
1089748882 11:120636296-120636318 AGGGGCACTCATGCTCCCCTGGG - Intronic
1090379709 11:126317950-126317972 AGGGCCTCTCCTGCCACCCCAGG + Intronic
1091119724 11:133046869-133046891 AGTGACACCCCTGCTGCCTTAGG + Intronic
1092498839 12:9025741-9025763 AGGGGCACTCTTTCTACCCAAGG - Intergenic
1093370567 12:18359761-18359783 ATGGCCACCCCTGCTCCCCTTGG + Intronic
1094856681 12:34405986-34406008 AAGGACACTCCTAGTCCCCTGGG - Intergenic
1096110016 12:49023071-49023093 AGGGACCCTTCTGACACCCTGGG + Intronic
1100042939 12:90342599-90342621 AAAAACATTCCTGCTACCCTTGG + Intergenic
1102743622 12:115230586-115230608 AGGGAGACCCCTGCTACAATAGG - Intergenic
1103883974 12:124187480-124187502 AGAGAACCTCCTGCTTCCCTGGG + Intronic
1104549171 12:129740122-129740144 TTGACCACTCCTGCTACCCTGGG + Intronic
1104960277 12:132485293-132485315 GGGAACACGCCTGCTCCCCTGGG + Intergenic
1106605346 13:31223729-31223751 TGGGTCATTCCTCCTACCCTGGG - Intronic
1107140470 13:36993213-36993235 AAGGACACACCTGCTTCCCAGGG + Intronic
1113387982 13:109868891-109868913 AGGGACACACCTGCCTCCCTGGG + Intergenic
1116523101 14:45872974-45872996 AGGGACACTGGTGCTAGCATGGG - Intergenic
1119874878 14:78050233-78050255 AGGGACTCTGCAGCTAGCCTGGG + Intergenic
1121048434 14:90804502-90804524 TGGGAAACTCCTGCCACACTTGG - Intronic
1122501186 14:102200902-102200924 AGGGACACTGCTGCCAGCCCAGG + Intronic
1128321612 15:66698596-66698618 AGTGACAGTCCTGCTGTCCTTGG - Intergenic
1128684494 15:69673589-69673611 AAGGACACTCCAGCTATTCTTGG + Intergenic
1129155047 15:73712487-73712509 AGGGGCCCTCCTCCTTCCCTTGG - Intronic
1129978435 15:79844248-79844270 AGTGTCACACCTGCTTCCCTTGG - Intronic
1131642483 15:94307427-94307449 AGGGACACTCCTGCTACCCTGGG - Intronic
1134007169 16:10825750-10825772 GGGGACCCTCCTTCTTCCCTTGG - Intergenic
1134136549 16:11680213-11680235 TGGGACACTCCTGCCTCCCCTGG - Intronic
1134242171 16:12514066-12514088 AGGCCCAATCCTGCCACCCTGGG - Intronic
1134379803 16:13713354-13713376 AAGCACTCTCCTGCTGCCCTGGG + Intergenic
1135708300 16:24694083-24694105 GGGGACTCTTCTGCTCCCCTTGG - Intergenic
1140815026 16:78613375-78613397 AGGGACACTCAGGCAACCCCAGG - Intronic
1141269656 16:82527673-82527695 AGGGACACTCTTGGTCCTCTTGG - Intergenic
1141496142 16:84411012-84411034 AGAGTCACTCCTGCTACCTGTGG - Intronic
1141707418 16:85674769-85674791 AGTGACACTGCTCCCACCCTGGG - Exonic
1142027052 16:87820012-87820034 AGGGTCTCTCCTGCTGCCCCAGG - Intergenic
1142667843 17:1472673-1472695 AGGCATACACCTGCTACTCTCGG - Intronic
1143999466 17:11039390-11039412 AGGGAGACTCCTACTAACCTGGG - Intergenic
1144855908 17:18267680-18267702 TGGCACAGTCCTGCTTCCCTTGG - Intergenic
1146106149 17:30039178-30039200 AGGGAAACTCAAGCTAGCCTGGG + Intronic
1148247054 17:46039317-46039339 AAGGACTGTCCTGCTGCCCTGGG - Intronic
1154197993 18:12280029-12280051 AGGGACACACACGCCACCCTGGG - Intergenic
1157094247 18:44672888-44672910 AGGCACATTCCTGGTACCCATGG - Intergenic
1157577326 18:48752243-48752265 AGAAACACTCCTGCCACCGTGGG - Intronic
1159903474 18:74069372-74069394 AGGGACTCTTGTGCAACCCTGGG + Intergenic
1160799422 19:960912-960934 TGGGACACCCCGGCTACCCTTGG - Intronic
1161362190 19:3856718-3856740 AAGGAAACTCTGGCTACCCTGGG - Intronic
1162535933 19:11262691-11262713 GGGGACGCTCTTTCTACCCTAGG + Intergenic
1167030778 19:46958502-46958524 AGGAAAACTCCTGCTAAGCTAGG - Intronic
1167372347 19:49090728-49090750 AGGGAGACCCCTGGTACCTTGGG + Intronic
1168408285 19:56121674-56121696 AGGGACGCTCGTGCCACCCCGGG + Intergenic
927924569 2:27002018-27002040 AAGGACACTCCTGCTGTCTTAGG + Intronic
930280828 2:49367664-49367686 GGGGACACTCCTGCTCCCAGAGG + Intergenic
938364811 2:130726581-130726603 AGGGACACTCCAGCATCCCCAGG + Intergenic
940100289 2:150029703-150029725 TGGGACACTCCTGCTCCCTTTGG - Intergenic
941954446 2:171190288-171190310 AGGAAAACTCCTGCTGCCCATGG + Intronic
947665800 2:231904634-231904656 ATGGACACTGCTGCAGCCCTGGG + Intergenic
948261083 2:236604921-236604943 AGGGCCCCTTCTGCTTCCCTAGG + Intergenic
948445728 2:238031288-238031310 TGGCAGACTCCTGCTCCCCTGGG + Intronic
948883926 2:240873718-240873740 AGGGACAGCCCTGCCACCCCAGG - Intronic
1171279558 20:23884229-23884251 AGGGAGAATCCTGCTGTCCTTGG + Intergenic
1171423282 20:25033077-25033099 AGAAACACTCCTGCTACTCCGGG + Intronic
1173985591 20:47259267-47259289 AGGGACACACGTGCTTCCTTGGG - Intronic
1174429281 20:50456187-50456209 AGGGCCCCTCCTGTGACCCTCGG - Intergenic
1176196192 20:63837185-63837207 AGGGACACAGCTGCTCCCCAGGG + Intergenic
1177604161 21:23357235-23357257 TGACACACTCCAGCTACCCTGGG + Intergenic
1181452544 22:23033596-23033618 AGTGGCTCTCCTGCTACCCATGG + Intergenic
1182573091 22:31253767-31253789 AGGGATAATCCTGCTACCGTAGG + Intronic
1182920581 22:34075588-34075610 AGAGACCCTGCTGCTCCCCTGGG + Intergenic
1183061463 22:35338797-35338819 AGGGGCCATCCTGCCACCCTGGG + Intronic
1183811781 22:40263778-40263800 TGTGACACCCCTGCCACCCTGGG + Intronic
1184393341 22:44218323-44218345 AGGGACACTGGTCTTACCCTTGG - Intronic
965687258 3:171317379-171317401 AGAGACACTCCAGCTATCCATGG + Intronic
967270515 3:187728770-187728792 GGGGACCATCCTACTACCCTTGG - Intronic
969493821 4:7514728-7514750 AGGGACACCCCTGTGAGCCTTGG + Intronic
969706269 4:8793981-8794003 AGGGGCACCCCAGCCACCCTGGG + Intergenic
969723805 4:8907617-8907639 AGGGCCAGGCCTGCCACCCTGGG - Intergenic
972719246 4:41679233-41679255 AGTGACACTCCTGATGCCTTGGG - Intronic
980269495 4:130565297-130565319 AGGGACACTACTGATACTTTGGG + Intergenic
981561660 4:146054995-146055017 CAGGATACTCCTGCTAGCCTGGG + Intergenic
982204029 4:152983635-152983657 AGGGACGGTCTTGCTAGCCTAGG + Intergenic
982914471 4:161188787-161188809 AGGAAAGCTCCTGCTAGCCTGGG - Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
989114723 5:37941377-37941399 AGGGACACACCTGCTGGGCTGGG - Intergenic
993641220 5:90408976-90408998 AGGGATAATCATGGTACCCTTGG - Intronic
994516251 5:100775917-100775939 AGGGGACCTCCTTCTACCCTGGG - Intergenic
995684004 5:114751048-114751070 AGGGACACCCCTGCTTCCCCAGG - Intergenic
995974589 5:118017906-118017928 ATGGACATTCCTGCAGCCCTTGG + Intergenic
999066132 5:148687371-148687393 AGGGGCCCTCCTGCCACTCTGGG + Intergenic
1001871660 5:175161353-175161375 AGGGACACACCTGCAACCTGGGG + Intergenic
1004551609 6:16653480-16653502 AAAGCCACACCTGCTACCCTTGG - Intronic
1006445309 6:34076660-34076682 AAGGCCTCTCCTGCTGCCCTGGG - Intronic
1007430113 6:41771547-41771569 TGGGACACTCCTGCCTCACTTGG - Intronic
1011217424 6:85019659-85019681 AGGGAAACTGCTGCCACTCTAGG - Intergenic
1012025586 6:93986134-93986156 AGGGACACAGCTGCTCCACTGGG - Intergenic
1013424793 6:110001349-110001371 AAGGAGTATCCTGCTACCCTGGG - Intergenic
1014925719 6:127267350-127267372 AGGGACCCGCCTGCCACCCGAGG - Intronic
1017029931 6:150212025-150212047 AAGGTCACTCCTACTACCCAAGG - Intronic
1019054539 6:169213735-169213757 TGGGACACTCCTGCTTCGCCCGG - Intergenic
1019492486 7:1321853-1321875 TGGGAGGCTCCTGCTGCCCTGGG - Intergenic
1023436401 7:40144526-40144548 AGGAAAACTCCAGCCACCCTGGG - Intronic
1024295935 7:47842405-47842427 AGGGAGACTCCCTCTGCCCTTGG - Intronic
1025245396 7:57313004-57313026 AGGGCCCCTCCTGTGACCCTCGG + Intergenic
1026211215 7:68307108-68307130 AGGGGCATTCCTGGCACCCTTGG + Intergenic
1026306155 7:69143644-69143666 GGGCTGACTCCTGCTACCCTGGG + Intergenic
1030337576 7:108342672-108342694 AGGGACAAGCCTGCAACCCATGG + Intronic
1035628216 8:1089485-1089507 AGGGTCTCTCCTGCTGCCCCAGG + Intergenic
1037758726 8:21727951-21727973 AGGCACACTCCTTCTACCATAGG + Intronic
1037861686 8:22409879-22409901 GGGGACACTCCTGCTGCCTGGGG - Intronic
1040621889 8:49100913-49100935 AGGGAAACTCAAGCCACCCTGGG + Intergenic
1042002044 8:64135117-64135139 TGGGACACTACTGCTTGCCTGGG - Intergenic
1045215745 8:100146606-100146628 AGGGACACTCCTGCTGCTCTTGG + Intergenic
1049231978 8:141489206-141489228 AGGGACACTCCTTCTGCCAAGGG - Intergenic
1050937161 9:11413393-11413415 AGGGACCCTCCTGCCACCACAGG + Intergenic
1052019804 9:23512588-23512610 AGGCCCACTCCTGCTCCCTTTGG - Intergenic
1052020956 9:23524692-23524714 AGGCACACTGCTGCTGCCCTGGG + Intergenic
1052339408 9:27350836-27350858 ATGCACACTCCAGCTACTCTTGG + Intronic
1056243857 9:84674810-84674832 ATGGACACTTTTGTTACCCTGGG + Intronic
1056760492 9:89411263-89411285 TGGGTCACTCTTGCTTCCCTGGG - Intronic
1056792278 9:89633566-89633588 AGGGTCACACCTGATTCCCTGGG + Intergenic
1057912504 9:99031081-99031103 AGGGACACTCCAGCCATTCTGGG - Intronic
1059906749 9:118995017-118995039 TGGAACCCTGCTGCTACCCTGGG - Intergenic
1060475827 9:123985817-123985839 AGGCACACTCCAGCTCCCTTTGG + Intergenic
1060518080 9:124278389-124278411 TGGGACACTACTGCTCACCTAGG - Intronic
1061474461 9:130854915-130854937 AGAAACACTCCTGGTACCATGGG + Exonic
1187023331 X:15407158-15407180 AGGCAGATTCCTGCTCCCCTTGG + Intronic
1189348300 X:40258989-40259011 AGGGCCACTCCTGCCTGCCTGGG - Intergenic
1191230404 X:58089111-58089133 AGGGACACTTCTGCGACCATAGG + Intergenic
1192328016 X:70149849-70149871 AAGGAGACTCCCGCCACCCTAGG - Intronic
1194938210 X:99977321-99977343 AGATACACTCCAGCTACCTTAGG + Intergenic