ID: 1131642667

View in Genome Browser
Species Human (GRCh38)
Location 15:94309205-94309227
Sequence ATCAGACGGCTCCACTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131642667 Original CRISPR ATCAGACGGCTCCACTAACC AGG (reversed) Intronic