ID: 1131643358

View in Genome Browser
Species Human (GRCh38)
Location 15:94315529-94315551
Sequence GTACCGGGGGAAGCCAGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131643350_1131643358 17 Left 1131643350 15:94315489-94315511 CCAAGACATACTGTCTTAACTGC 0: 1
1: 0
2: 2
3: 15
4: 222
Right 1131643358 15:94315529-94315551 GTACCGGGGGAAGCCAGTGATGG 0: 1
1: 0
2: 0
3: 11
4: 148
1131643349_1131643358 18 Left 1131643349 15:94315488-94315510 CCCAAGACATACTGTCTTAACTG 0: 1
1: 0
2: 1
3: 17
4: 211
Right 1131643358 15:94315529-94315551 GTACCGGGGGAAGCCAGTGATGG 0: 1
1: 0
2: 0
3: 11
4: 148
1131643352_1131643358 -5 Left 1131643352 15:94315511-94315533 CCTTCTCCATCTGTGCAGGTACC 0: 1
1: 0
2: 2
3: 11
4: 198
Right 1131643358 15:94315529-94315551 GTACCGGGGGAAGCCAGTGATGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131643358 Original CRISPR GTACCGGGGGAAGCCAGTGA TGG Exonic
901287338 1:8091371-8091393 GTGACAGGGGAAGCCATTGAGGG + Intergenic
901321526 1:8343162-8343184 GTGCTGGGGGAGCCCAGTGAGGG + Intronic
902753139 1:18531422-18531444 GAATAAGGGGAAGCCAGTGAGGG - Intergenic
903661290 1:24980349-24980371 GTACCTGGGGAAGCTTATGATGG - Intergenic
903999858 1:27332770-27332792 CTGCCGGAGGAAGCCAGAGAGGG - Intronic
904882986 1:33714666-33714688 GTACCCGGGGAAGCAGGAGAAGG + Exonic
905857747 1:41325594-41325616 GTGCAGAGGGAAGCCACTGAGGG + Intergenic
917927655 1:179802659-179802681 GTAGCTGGGGCAGCCACTGAGGG - Intronic
919486174 1:198150009-198150031 GTACCCAGGGCAACCAGTGAAGG + Intergenic
921022004 1:211244413-211244435 GTACTGAGGGAAGAGAGTGAAGG + Intergenic
921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG + Intergenic
924461066 1:244258883-244258905 GATCCTGGGGAAGCCAGTGCAGG + Intergenic
1063933819 10:11056875-11056897 GTACTGGGGGAAGTCTGTGCAGG + Intronic
1069844580 10:71362223-71362245 GTACAGGAGGAAGGTAGTGAGGG - Exonic
1070779669 10:79130197-79130219 GTGATGGGGGAAGCCAGGGAGGG - Intronic
1071347246 10:84704426-84704448 GTCCCTGGGGAAGCATGTGAGGG - Intergenic
1071549702 10:86557169-86557191 GTGCCAGGGGAAGCCAGAGGAGG + Intergenic
1074898380 10:117796186-117796208 GTCCTGGAGGAAGCCAGTGCTGG + Intergenic
1075835016 10:125445560-125445582 ACACCGTGGGAAGCCAGAGAAGG - Intergenic
1075926879 10:126258537-126258559 GCACCAGGGGAAGCCACTGAAGG - Intronic
1079139317 11:17797234-17797256 GTAACAGGAGAAGCCACTGAAGG - Intronic
1081940923 11:46941204-46941226 GAACCAGGAGAAGGCAGTGAGGG - Intronic
1083611969 11:64008591-64008613 GTGCTAGGGGAAGACAGTGAGGG + Intronic
1084170273 11:67397527-67397549 GTGCTGGCGGAAGACAGTGAGGG + Exonic
1089113762 11:116077865-116077887 GGTTCTGGGGAAGCCAGTGAGGG + Intergenic
1092727148 12:11497682-11497704 GCCCAGGGGGAAGGCAGTGAGGG + Intronic
1096417570 12:51426806-51426828 GAACAAGGGGAAGCCACTGAAGG + Intronic
1101400129 12:104379851-104379873 GGACCAGAGGAAGCCAGTCATGG + Intergenic
1104048478 12:125180775-125180797 AGACTGAGGGAAGCCAGTGATGG - Intergenic
1104773158 12:131377158-131377180 GTTGGGGGGGAAGCCAGAGAGGG + Intergenic
1104984928 12:132591422-132591444 GCTCCGGAGAAAGCCAGTGAGGG - Intergenic
1105205688 13:18221619-18221641 GGACTGGGGAAAGACAGTGAAGG + Intergenic
1110775308 13:79402486-79402508 GGATAGTGGGAAGCCAGTGAAGG - Intronic
1114727650 14:24955640-24955662 GTACCGTGGTAAGGAAGTGAGGG + Intronic
1119462520 14:74819845-74819867 GAAGCAGGAGAAGCCAGTGAAGG - Intronic
1121227400 14:92331176-92331198 TTACCAGGGAAAGCCTGTGAAGG - Intronic
1121868824 14:97388477-97388499 GTAGTTGGGGGAGCCAGTGAAGG + Intergenic
1122031960 14:98918946-98918968 GTTCAGGGGGAGGCCAGAGAGGG - Intergenic
1122478479 14:102029107-102029129 CTACCAGGGGAAGCCAGGGCTGG - Intronic
1122691499 14:103533960-103533982 GGACCTGGGGAAGCCAGGGCCGG - Intronic
1127198690 15:56619443-56619465 GCACTTTGGGAAGCCAGTGAGGG - Intergenic
1129651438 15:77493494-77493516 GTGCAGGGGGAAGTCACTGAAGG + Intergenic
1129889496 15:79062415-79062437 GAACGGTGGGAAGCCATTGAGGG - Intronic
1131381517 15:91968086-91968108 GTACCCAGGGAAGCCACTTACGG + Intronic
1131643358 15:94315529-94315551 GTACCGGGGGAAGCCAGTGATGG + Exonic
1132907460 16:2290201-2290223 GGACTGGGAGAATCCAGTGAGGG - Intronic
1133622192 16:7537045-7537067 GTACCATGGGAGGCCATTGAAGG + Intronic
1134186595 16:12089715-12089737 GTACAATGGGAAGCCAGTGGAGG + Intronic
1134403417 16:13933460-13933482 GTACTTTGGGAAGCCAGTGCAGG + Intronic
1136172590 16:28497724-28497746 GAACAGAGGGAAGACAGTGAGGG + Exonic
1138454858 16:57115420-57115442 GAAGCGGGGGAAGCCCGGGAAGG - Intronic
1138456946 16:57126509-57126531 GTACCACGGAAAGTCAGTGAAGG + Intronic
1139111505 16:63897020-63897042 GTGGAGGGAGAAGCCAGTGAGGG + Intergenic
1139914118 16:70417760-70417782 GGACCAGGGGAAGCCAGAGAGGG + Intronic
1143185619 17:5008326-5008348 GTACCGGTGCATACCAGTGAAGG + Intronic
1148885158 17:50767116-50767138 GCACAGGGTGAGGCCAGTGAAGG + Intergenic
1152274995 17:79350924-79350946 TTACCAGGGGATGCCAGGGAGGG - Intronic
1155552076 18:26975202-26975224 CTTCCAGGAGAAGCCAGTGAGGG + Intronic
1156837268 18:41569034-41569056 GTGCATGGGGAAGCCAGTAAAGG - Intergenic
1157567853 18:48691830-48691852 ATACCTGGGGCAGCAAGTGAGGG - Intronic
1158955272 18:62532089-62532111 GTTCCAGTGGGAGCCAGTGAAGG + Intronic
1160329224 18:77977206-77977228 GCCCCGGGGGAGGCCAGTGGTGG - Intergenic
1160476514 18:79194540-79194562 TGACCGGAGGAAGCCATTGAAGG + Intronic
1160662075 19:305935-305957 GTACCGGGGGAGGACAGCAAAGG + Exonic
1161027414 19:2042967-2042989 GTGCTGGAGGAAGCCAGTGTGGG - Intronic
1161136965 19:2625630-2625652 GTTGCCAGGGAAGCCAGTGAAGG + Intronic
1161478666 19:4499863-4499885 ATCCCTGGGGCAGCCAGTGAGGG + Intronic
1161851568 19:6740300-6740322 GAGCAGGGGGAAGCCAGGGAGGG - Intronic
1163015498 19:14451711-14451733 GTACAAGTGGGAGCCAGTGAGGG - Intronic
1163554708 19:17985293-17985315 GTACCTGGGGGAGCCAGAGTGGG - Exonic
1164067654 19:21734195-21734217 GAACCGGGAGAAGCCTGAGATGG + Intronic
1165068802 19:33243423-33243445 GCACCTGGGGAAGCCAGTGTGGG + Intergenic
1167101541 19:47407056-47407078 GTACAGGGGGAAGGCGGGGACGG - Intronic
932183873 2:69674551-69674573 GTTCCTGGGCAAGCTAGTGAAGG + Intronic
933747039 2:85579003-85579025 GCACAGGAGGAAGCCAGTGAAGG + Exonic
935067133 2:99658894-99658916 TTATCTGGGGATGCCAGTGAAGG + Intronic
937490929 2:122366455-122366477 GTAGGGGGGGAAACCAGAGAGGG + Intergenic
940335137 2:152518901-152518923 GTGCCACGGGAAGCCATTGAAGG - Intronic
948393288 2:237627464-237627486 GACCCGGGGGAAGCCAGAGCCGG - Intergenic
1176515059 21:7777692-7777714 GTTCCAGGAGAAGCCAGAGATGG - Intergenic
1178491945 21:33057988-33058010 GTGCTGGGGGAGGCCAGGGAAGG + Intergenic
1178649087 21:34407704-34407726 GTTCCAGGAGAAGCCAGAGATGG - Intronic
1179023042 21:37656952-37656974 GTTCCAGGGGATGTCAGTGATGG + Intronic
1179036062 21:37759564-37759586 GGACAATGGGAAGCCAGTGATGG - Intronic
1180916849 22:19494770-19494792 GTCCCGGGGGAAGCCCTTGCTGG + Intronic
1182765237 22:32753543-32753565 GAAACGTGGGGAGCCAGTGAAGG - Intronic
1184142608 22:42586923-42586945 GTACAGTGGGAAGCCATTGAAGG - Intronic
1184217456 22:43077189-43077211 GTACCTGGGGAAGCAGGTGAGGG - Intronic
1184938107 22:47739858-47739880 GGTCCGGGGGAAGCCAGTGTGGG + Intergenic
1184995016 22:48199210-48199232 GGGCCTGGGGAAGACAGTGAGGG + Intergenic
950419842 3:12892458-12892480 GTGCCAGGGGCAGCCAGTGGGGG - Intergenic
951073404 3:18360343-18360365 CTACCTTGGGAAGCCACTGAAGG - Intronic
952873912 3:37925723-37925745 GTACATGTGGAAGCCAGTGGAGG + Intronic
954744820 3:52781489-52781511 GTGCTTGGGGAAGCTAGTGATGG - Intronic
961186626 3:124920595-124920617 GTTCCTGGGGGAACCAGTGAGGG - Intronic
962848259 3:139289318-139289340 CTACCCAGGGAAGCCAGTGATGG + Intronic
964400247 3:156291019-156291041 GAACTGGGGGAAGGCAGAGAGGG - Intronic
968814069 4:2812684-2812706 GCACAGGGGGAGGCCAGAGAGGG + Intronic
969881650 4:10179186-10179208 GTACAAGGTTAAGCCAGTGAGGG + Intergenic
970223077 4:13830476-13830498 GCACAGGCTGAAGCCAGTGAGGG - Intergenic
971029841 4:22624048-22624070 CTTCCAGGAGAAGCCAGTGAGGG + Intergenic
980550403 4:134327834-134327856 GCAGAGGGGAAAGCCAGTGAGGG + Intergenic
980940180 4:139266627-139266649 TTACAGGAGGAAGCCAGTGTTGG - Exonic
983684944 4:170397280-170397302 GCACCAGGGGATGCCAGTTAGGG + Intergenic
985090975 4:186362422-186362444 GGACAGGGGGATGCCAGGGAGGG - Intergenic
987510073 5:18825603-18825625 GTACCTTGGGAGGCCAGTGTGGG - Intergenic
987709765 5:21492313-21492335 GTCCCAGGGCCAGCCAGTGAAGG + Intergenic
988749847 5:34181850-34181872 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
991738107 5:69645054-69645076 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
991760088 5:69911370-69911392 GTCCCAGGGTCAGCCAGTGAAGG + Intergenic
991787245 5:70206730-70206752 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
991789683 5:70224780-70224802 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
991814432 5:70499890-70499912 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
991817567 5:70521182-70521204 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
991839318 5:70786421-70786443 GTCCCAGGGTCAGCCAGTGAAGG + Intergenic
991879691 5:71207120-71207142 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
991882130 5:71225149-71225171 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
993910051 5:93670286-93670308 GTACAGTGGGAAACCACTGAGGG - Intronic
994421886 5:99533632-99533654 GTCCCAGGGTCAGCCAGTGAAGG + Intergenic
994460956 5:100066949-100066971 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
994485103 5:100380377-100380399 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
999272024 5:150302344-150302366 GACCAGGGAGAAGCCAGTGAGGG + Exonic
999717191 5:154370715-154370737 GAGCCAGGGGAAGCCATTGAAGG + Intronic
1002104943 5:176875379-176875401 GAACTGGGGGAAGCCAGGAATGG - Intronic
1002326941 5:178415865-178415887 GTACTGGGTGAGGCCAGGGAGGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003015319 6:2463060-2463082 GGACAGGCGGAAGCCAGTGATGG - Intergenic
1003020567 6:2505532-2505554 GGACAGGAGGAAGCCATTGATGG - Intergenic
1004279624 6:14269754-14269776 CTACCTTGGGAAGCCAGGGAAGG - Intergenic
1005547913 6:26888193-26888215 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
1007528318 6:42516549-42516571 GGACCGGGGGAAGGAAGGGAGGG + Intergenic
1009018674 6:57929274-57929296 GTCCCAGGGTCAGCCAGTGAAGG - Intergenic
1013179865 6:107708612-107708634 GTACCTGGGGCAGTGAGTGAGGG - Intronic
1018662223 6:166098715-166098737 GCAGCCGGGGAAGGCAGTGAGGG + Intergenic
1019352110 7:559232-559254 GTTCAGGGGGCGGCCAGTGAAGG + Intronic
1019736551 7:2652750-2652772 GTCCCGGGGGAAGCAAGGGCAGG + Intronic
1025731734 7:64114051-64114073 GTCCCGGGGTCAGCCAGGGAAGG + Intronic
1027241153 7:76330047-76330069 GTACCGGGAGAAGATAGAGAAGG - Exonic
1032717689 7:134524695-134524717 GAACGGGAGGAAGCCAGTGTGGG - Intergenic
1033138472 7:138804094-138804116 GTTCTAGGGGAAGGCAGTGAAGG - Exonic
1034575623 7:151994595-151994617 GTTCCAGGGGAAGCCAATCACGG - Intronic
1035105578 7:156439674-156439696 AAACCTGGAGAAGCCAGTGAAGG - Intergenic
1035459404 7:159029903-159029925 GGACAGAGGGAAGCCAGTCAGGG - Exonic
1037822605 8:22142157-22142179 ACACCGGGAAAAGCCAGTGAAGG - Intergenic
1039765627 8:40625226-40625248 GAACGGAGGGAAGGCAGTGAGGG + Intronic
1041056253 8:53989546-53989568 ATACAGGGGGAAATCAGTGAAGG - Intronic
1041237252 8:55816694-55816716 GTGCCTGGGGAAGCCATGGAAGG - Intronic
1044325048 8:90849221-90849243 GTACTGTGGGAAGCCACAGAAGG + Intronic
1047388376 8:124430428-124430450 GTACAGTGGGAAGACAGTGGAGG + Intergenic
1047574482 8:126137765-126137787 GGACTGGGGGAAGAGAGTGAAGG + Intergenic
1047982635 8:130198854-130198876 GTTCAGTGGGAAGCCAATGATGG - Intronic
1049813198 8:144585472-144585494 GCACGAGGGGAAGCCAGTGCTGG - Intronic
1052750486 9:32484751-32484773 GGGCCAGGGGAAGACAGTGAAGG - Intronic
1056166130 9:83942532-83942554 GTACCATTGGAAGCCAGTTAAGG + Intronic
1057901358 9:98951385-98951407 GTACAGTGAGAACCCAGTGAGGG - Intronic
1061037272 9:128120779-128120801 GAACCAGGGGAACCCAGGGATGG + Exonic
1203736816 Un_GL000216v2:144835-144857 TTTCCGGGGGAAGGCAGTGGGGG - Intergenic
1188033252 X:25288183-25288205 GTCCCGGGGGAAGCCAGTACAGG + Intergenic
1189171520 X:38914060-38914082 GTTCCAGAGGAAGCCAGTGTAGG + Intergenic
1202368013 Y:24179894-24179916 GAACCTGGGGAAGGCAGGGAGGG + Intergenic