ID: 1131643739

View in Genome Browser
Species Human (GRCh38)
Location 15:94319632-94319654
Sequence AAACCCATGCTTCTCCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131643737_1131643739 10 Left 1131643737 15:94319599-94319621 CCCTGTCACAGGTGGGTGTCGGC 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1131643739 15:94319632-94319654 AAACCCATGCTTCTCCTTAGAGG 0: 1
1: 0
2: 1
3: 16
4: 141
1131643732_1131643739 27 Left 1131643732 15:94319582-94319604 CCTTTGCTCTAGGCAGTCCCTGT 0: 1
1: 0
2: 3
3: 31
4: 241
Right 1131643739 15:94319632-94319654 AAACCCATGCTTCTCCTTAGAGG 0: 1
1: 0
2: 1
3: 16
4: 141
1131643738_1131643739 9 Left 1131643738 15:94319600-94319622 CCTGTCACAGGTGGGTGTCGGCA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1131643739 15:94319632-94319654 AAACCCATGCTTCTCCTTAGAGG 0: 1
1: 0
2: 1
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131643739 Original CRISPR AAACCCATGCTTCTCCTTAG AGG Intronic
900688907 1:3967425-3967447 ACACCCATGGGTCTCCTTACAGG - Intergenic
902278659 1:15358553-15358575 AAACCAACGCTTCTCATTAGGGG - Intronic
908470345 1:64437953-64437975 AAACCCATGTTTTTCCAAAGAGG - Intergenic
913344424 1:117793859-117793881 AAGTCCATTCTCCTCCTTAGGGG + Intergenic
915192164 1:154160551-154160573 AAACCAATGGTTCTCAATAGGGG + Intronic
915573475 1:156759281-156759303 CAACCCAGTTTTCTCCTTAGAGG + Intronic
915577652 1:156791094-156791116 AATCTCATGATTCCCCTTAGAGG - Intronic
915610187 1:156985814-156985836 ACACCCATGCTTATCAGTAGTGG - Intronic
916086527 1:161274238-161274260 AAATCCTTCCTTCTCCTTATAGG - Intronic
916261626 1:162848031-162848053 AAACCAATGCTGCCCCCTAGTGG - Intronic
923394020 1:233543075-233543097 AAACCAATTGTTCTCCTTGGTGG - Intergenic
1067993905 10:51247166-51247188 AAACCCCTGCTTCTTCCTATAGG + Intronic
1070844422 10:79510242-79510264 ACACCCCTGCTTCTCCTTTCTGG - Intergenic
1070929375 10:80250066-80250088 ACACCCCTGCTTCTCCTTTCTGG + Intergenic
1071151158 10:82636086-82636108 AGAGCCATGCTTCTCTTTGGAGG + Intronic
1071617128 10:87085681-87085703 GACCCCAGTCTTCTCCTTAGGGG + Intronic
1072566340 10:96619755-96619777 AATCCCAGTCTTCTCCTGAGAGG + Intronic
1076778605 10:132711536-132711558 AACCCCATTCTGCTCCCTAGAGG + Intronic
1077026753 11:443036-443058 CCACCCATGTTTCTCCTTGGGGG + Intergenic
1077601841 11:3580142-3580164 AAACCCATGTGCCTCCTCAGTGG + Intergenic
1078910447 11:15726218-15726240 GAAACCATGCATCTGCTTAGAGG - Intergenic
1080395098 11:31882825-31882847 AAAACTATGCTTCTGCTTAAAGG + Intronic
1082816311 11:57512135-57512157 AAACTCCTGCTTCTCTTTAGAGG - Intronic
1084257755 11:67954688-67954710 AAACCCATGTGCCTCCTCAGTGG + Intergenic
1088792937 11:113242110-113242132 GAATCCATCCTTCACCTTAGAGG - Intronic
1089709577 11:120305475-120305497 AAACCGATTCTTCACCTTAGAGG + Intronic
1090808153 11:130215712-130215734 ATACACAGGCTTCTCCTTGGTGG - Intergenic
1097588075 12:61539168-61539190 AAACACATACTTATCCTTTGTGG - Intergenic
1098149207 12:67529264-67529286 AAATACATCTTTCTCCTTAGGGG + Intergenic
1098625515 12:72660885-72660907 AAACCCCTGCCTCACCTTAGAGG - Intronic
1101950792 12:109173349-109173371 AAATCCCTGCTTCTCCTTACCGG + Intronic
1104514288 12:129410008-129410030 GAATCCATGTTTCTCTTTAGAGG - Intronic
1107356494 13:39572796-39572818 AAAGCCATCTTTCTCCTAAGTGG + Intronic
1108127645 13:47261770-47261792 AAACACATGCTGCCCCTGAGTGG - Intergenic
1109929944 13:69202559-69202581 AAAACTAGGCTTCCCCTTAGAGG + Intergenic
1112442973 13:99438263-99438285 AAACCCATGCATCTGATAAGGGG + Intergenic
1115387551 14:32815012-32815034 AAACCCCTGCTTCCCATTACTGG + Intronic
1115964622 14:38873814-38873836 AAACTCAAGCTTATCCTTAGTGG - Intergenic
1116071129 14:40047174-40047196 AAACACATCCTTCTTCTTGGTGG + Intergenic
1118728701 14:68651510-68651532 AAACCCATCCTTCTGGATAGTGG - Intronic
1121780247 14:96617626-96617648 CAACCCATGCTCCTCTTTGGGGG - Intergenic
1124043391 15:26125554-26125576 AAACCCATGGTTCTCCTCCATGG - Intergenic
1125301203 15:38254373-38254395 AAACACACGCTTCTGCTGAGCGG + Intronic
1126637659 15:50794994-50795016 AAACCCTTGAATCTCCTGAGTGG + Intergenic
1131643739 15:94319632-94319654 AAACCCATGCTTCTCCTTAGAGG + Intronic
1137717476 16:50607357-50607379 AAACCCAACCCTCTCCTTAGGGG - Intronic
1138082453 16:54103439-54103461 AAAGCCAGACTTCTCCCTAGGGG - Intronic
1138194443 16:55042097-55042119 AAAGCCACACTGCTCCTTAGTGG - Intergenic
1142913736 17:3116689-3116711 AAACCCATCCATCCCCTTTGCGG + Intergenic
1143780349 17:9225845-9225867 AAACCCCAGGTTCTCATTAGCGG - Intronic
1144090710 17:11853824-11853846 AAACCAAAGCTACTCCTCAGTGG - Intronic
1144825076 17:18101203-18101225 AAACCCAGGCTTCCCCTGAGGGG + Intronic
1147788598 17:42998469-42998491 CAACCCAAGCTTCTACTTACCGG - Exonic
1148383866 17:47220806-47220828 ACACACATGCTTCTCCTCAGTGG + Intronic
1148478807 17:47946592-47946614 AAACCTCTGCTTCTCCTTATAGG + Exonic
1151543118 17:74775521-74775543 CAACCAATGTTTCTTCTTAGGGG + Intronic
1152229639 17:79108028-79108050 AATTCCATGCTGCCCCTTAGGGG + Intronic
1154472668 18:14720341-14720363 AACCCAATTCTTCTCCTTAATGG - Intergenic
1156063613 18:33113846-33113868 AAAAGAATGCTTCACCTTAGTGG + Intronic
1160023541 18:75200439-75200461 ATACATTTGCTTCTCCTTAGAGG - Exonic
1160193883 18:76737311-76737333 AAACCCATCCTTCACTTTGGGGG - Intergenic
925812119 2:7711112-7711134 AAAACAATCCTTCTCCTTGGTGG + Intergenic
925896048 2:8473049-8473071 AAACTCTTGCTTTTGCTTAGAGG - Intergenic
926842910 2:17103316-17103338 AAATCCATGCAGCACCTTAGAGG + Intergenic
930192119 2:48470720-48470742 GAACACCTGCTTCTCCATAGAGG - Intronic
930982501 2:57544719-57544741 AAACTCATGCTACTCCTCAGTGG - Intergenic
931901055 2:66788623-66788645 AAACCCCTGCCTTACCTTAGAGG + Intergenic
934524826 2:95045325-95045347 CAACCCAAGCTGCTCCTTTGGGG + Intronic
934794040 2:97085624-97085646 GAACCCATGCTCCTCCCTGGAGG + Intronic
935284364 2:101550897-101550919 AAACGCATGCTTCTCCTAAGTGG + Intergenic
935298685 2:101673784-101673806 AAAGAAATGCTTCTCCTAAGTGG - Intergenic
938094794 2:128454511-128454533 GAACCCCTGCTTTTGCTTAGGGG + Intergenic
944473892 2:200084745-200084767 AAACCCATTATTCTCCCTAATGG + Intergenic
944535159 2:200701973-200701995 ACACCCATGCCTCTCCTTGTTGG - Intergenic
945792663 2:214324748-214324770 AACTCCATGTTTCTCTTTAGTGG + Intronic
946043614 2:216803412-216803434 AACCCCAAGCTTCTCCTCAAAGG + Intergenic
947509355 2:230736596-230736618 AAAATTATGCTTCTCCTAAGTGG - Intronic
948519247 2:238525032-238525054 AAACACATCCTGCTCCTTGGAGG - Intergenic
1170404024 20:16017663-16017685 AAACAGATGTTTCTCCTTAGGGG - Intronic
1174959416 20:55138235-55138257 TAACCCATCCTGTTCCTTAGGGG + Intergenic
1175335277 20:58192014-58192036 AGACCCCAGCTTCTCCTTTGTGG - Intergenic
1176801821 21:13437516-13437538 AACCCAATTCTTCTCCTTAATGG + Intergenic
1177877373 21:26650079-26650101 AAAGACATGCTTCTCCTGACAGG + Intergenic
1178714858 21:34954951-34954973 AATCCCATGCTTCTCATCAAAGG - Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949814079 3:8040076-8040098 AAACCCTTGATTATCCTTAAAGG + Intergenic
952880386 3:37982071-37982093 AAATCCATGCTACACCTAAGTGG - Exonic
953040284 3:39250246-39250268 AAGCCAATACTTCTCCTTTGAGG - Intergenic
961281390 3:125767575-125767597 AAACCCATGTGCCTCCTCAGTGG - Intergenic
962757656 3:138478797-138478819 AAACCAATTCTTGTCCTCAGTGG - Intronic
963570027 3:146982057-146982079 AGACCCATTCTTCACCTTATGGG - Intergenic
971166306 4:24187445-24187467 AAACCCATGATTTTCCTTTTAGG - Intergenic
971501081 4:27318496-27318518 AAACCCCTGCTCATCCTTTGAGG - Intergenic
972301639 4:37790637-37790659 AAAACCATTATTCTCCTTGGTGG - Intergenic
974294599 4:59980808-59980830 AAAACAATTGTTCTCCTTAGGGG - Intergenic
976636653 4:87293079-87293101 AAACCCATGCCTCTACTGATCGG - Intergenic
977269711 4:94901282-94901304 AAAACAATGCTTATCCTTACAGG - Intronic
977675198 4:99739795-99739817 AAACAATTGCTTCTCCTTTGGGG + Intergenic
978985018 4:115001446-115001468 AAACCCATGAATCTCCTAACAGG - Intronic
980069424 4:128228040-128228062 AAATGCAGGCCTCTCCTTAGAGG + Intergenic
982495170 4:156082144-156082166 AAAGCCATGGTACCCCTTAGTGG - Intergenic
983986469 4:174065861-174065883 AAAACAATACTTCTCCTAAGAGG + Intergenic
985866311 5:2517144-2517166 CAACACATGCTCCTCCTCAGGGG - Intergenic
986361787 5:6985451-6985473 AAATCCATGCTGATCTTTAGAGG - Intergenic
993665439 5:90689679-90689701 AAACCCATTTTTCTACTGAGAGG + Intronic
994183207 5:96790408-96790430 AAAACAATGATTCTCCTCAGAGG + Intronic
996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG + Intronic
997153732 5:131528409-131528431 ATACCCAAGGTTCTCCTTTGGGG - Intronic
998779020 5:145635695-145635717 AAAGCCAGGCTTCACTTTAGAGG - Intronic
998979031 5:147680308-147680330 AAATCCATGCTTCTGCTTCTGGG + Intronic
1000182214 5:158822430-158822452 CAACCCATGGTTCTTCTGAGTGG + Intronic
1004483464 6:16042992-16043014 AATCCCAAGCTCCTCCCTAGAGG - Intergenic
1007614822 6:43173652-43173674 CTACCCATGCTCCTCCTTTGAGG - Intronic
1008154282 6:47994714-47994736 AAACCCATGGGTTTCCTTGGAGG + Intronic
1008154679 6:47999278-47999300 ATTCCCATGCTTATGCTTAGAGG - Intronic
1012963374 6:105646385-105646407 AAACCCAGGCTTCTCATAACTGG + Intergenic
1013248883 6:108314695-108314717 AAACCCCTTCTGCTTCTTAGAGG + Intronic
1017457078 6:154610867-154610889 AAGACCATTCATCTCCTTAGCGG - Intergenic
1018590781 6:165419258-165419280 AAAGCCATGTATCTCCTTAGAGG - Intronic
1020152245 7:5691596-5691618 AATGCCCAGCTTCTCCTTAGGGG + Intronic
1022822957 7:33979373-33979395 AAACAGTTGCTTCTCCTTGGGGG - Intronic
1024672294 7:51607192-51607214 AAACCCAAGCCTGTCCTTGGTGG + Intergenic
1026111580 7:67462788-67462810 GAACCCTGGCATCTCCTTAGGGG - Intergenic
1029738880 7:102480308-102480330 GGACCCATGCTTCTGCTCAGGGG + Intergenic
1029756881 7:102579471-102579493 GGACCCATGCTTCTGCTCAGGGG + Intronic
1029774820 7:102678531-102678553 GGACCCATGCTTCTGCTCAGGGG + Intergenic
1030341434 7:108385219-108385241 AAACCCTTGTATTTCCTTAGAGG + Intronic
1030344450 7:108416624-108416646 AAACCCAAGTTTTTCCTTGGGGG - Intronic
1033015023 7:137662662-137662684 AAACTCAGACCTCTCCTTAGAGG + Intronic
1034889119 7:154824054-154824076 AATTCCATTCTTCTCCTTAGTGG + Intronic
1035206134 7:157295119-157295141 AAACCCATGCATCTCCTGCGTGG - Intergenic
1035666397 8:1383625-1383647 AATTCCATGGTTCCCCTTAGTGG + Intergenic
1037103549 8:15077794-15077816 AGACCCATGCATCTCAATAGAGG + Intronic
1037662566 8:20940352-20940374 AAACCCACGCTTCTGGGTAGTGG + Intergenic
1042696423 8:71558385-71558407 AAACCAATTCTTGCCCTTAGCGG + Intronic
1044780754 8:95741094-95741116 AAGCCCTTGCCTCTTCTTAGAGG + Intergenic
1044899723 8:96931297-96931319 AAACACATACTTGTCCTTTGTGG - Intronic
1046166600 8:110444844-110444866 ATAGGGATGCTTCTCCTTAGTGG + Intergenic
1048423285 8:134298136-134298158 AAATCCAGGCTTCTGCATAGAGG - Intergenic
1049344287 8:142130237-142130259 GAACCAAAGCTTCTCCTTTGTGG + Intergenic
1050770450 9:9191926-9191948 AAATCCATGTTTCTCCTTAATGG - Intronic
1051054232 9:12964923-12964945 CAACCCAGGCCTCTCTTTAGAGG - Intergenic
1055089205 9:72345558-72345580 AAACACATGCCTCTTATTAGAGG - Intergenic
1055133648 9:72804774-72804796 AAATCCATGCTTCTTCATATTGG - Intronic
1056756370 9:89384672-89384694 AACCCCATGCTTGTCATCAGGGG + Intronic
1056982255 9:91325948-91325970 AAATCTATGCTTCTCCCTTGTGG - Intronic
1058652822 9:107192858-107192880 GAACCCATTTTTCTCCTTATAGG + Intergenic
1059607566 9:115851056-115851078 AAACTCATCCTACTCCTTGGTGG - Intergenic
1187432393 X:19237026-19237048 AGACAGATGCCTCTCCTTAGAGG - Intergenic
1187800244 X:23053803-23053825 AAACCCCTGCTTCCCTTTACTGG - Intergenic
1188946981 X:36317214-36317236 AAAACCATGCTTATCCTGATTGG - Intronic
1189611840 X:42745094-42745116 CAACTCATGCTTCACATTAGGGG + Intergenic
1189655311 X:43238917-43238939 AAACCAAAGTTGCTCCTTAGAGG - Intergenic
1189664771 X:43342390-43342412 AAAACAATTGTTCTCCTTAGTGG - Intergenic
1190297153 X:49034391-49034413 GAACCCTTGCTTCTCCTTCAAGG + Intronic
1190770318 X:53508651-53508673 AAAACAATGGTTCTCCTTGGTGG + Intergenic
1193248385 X:79258470-79258492 ATAATCTTGCTTCTCCTTAGTGG - Intergenic
1197386871 X:125813082-125813104 CAACTTATGCTTCACCTTAGAGG + Intergenic
1199806079 X:151301732-151301754 TCACCCAGCCTTCTCCTTAGAGG - Intergenic