ID: 1131646281

View in Genome Browser
Species Human (GRCh38)
Location 15:94348530-94348552
Sequence AACGTCTCCTGGTTCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131646281_1131646283 7 Left 1131646281 15:94348530-94348552 CCAGGTGAGAACCAGGAGACGTT 0: 1
1: 0
2: 0
3: 13
4: 88
Right 1131646283 15:94348560-94348582 TGTTTGTAGTCATATATCTTTGG 0: 1
1: 0
2: 0
3: 39
4: 331
1131646281_1131646284 8 Left 1131646281 15:94348530-94348552 CCAGGTGAGAACCAGGAGACGTT 0: 1
1: 0
2: 0
3: 13
4: 88
Right 1131646284 15:94348561-94348583 GTTTGTAGTCATATATCTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 295
1131646281_1131646285 17 Left 1131646281 15:94348530-94348552 CCAGGTGAGAACCAGGAGACGTT 0: 1
1: 0
2: 0
3: 13
4: 88
Right 1131646285 15:94348570-94348592 CATATATCTTTGGGTTGAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131646281 Original CRISPR AACGTCTCCTGGTTCTCACC TGG (reversed) Intronic
901917533 1:12511403-12511425 ATCCCCTCCTGGTTCTCACCAGG + Exonic
903445634 1:23420916-23420938 ACCGTCCCCTGGTGCTCCCCAGG - Intronic
907357508 1:53888459-53888481 AATATCTCCTGGTTGTGACCAGG - Intronic
908085334 1:60625958-60625980 AACTTTTCCTGGTTCTCATTTGG - Intergenic
909040464 1:70643227-70643249 AACCTCTTCTTGTTCTCACTGGG + Intergenic
910484308 1:87695840-87695862 AACCTCTTGTGGTTCTCACTTGG + Intergenic
912958929 1:114177767-114177789 CACGACTCCTGATTCTCACCAGG - Intergenic
914372247 1:147037327-147037349 AACTTCTCCATGTTCTCACCTGG - Intergenic
914577263 1:148985518-148985540 AACTTCTCCCTGTTCTCACCTGG + Intronic
914752618 1:150545820-150545842 TATGTCTCCAGGTTGTCACCAGG + Intergenic
920340593 1:205272936-205272958 GACCTCTCCTGGTACTCAGCAGG - Exonic
1065220955 10:23495484-23495506 AATGTTTCATGGTTCTCAACCGG - Intergenic
1068230462 10:54164916-54164938 AAGGTCTACTGGGTCTCTCCAGG + Intronic
1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG + Intergenic
1071409379 10:85373837-85373859 AACATCACCTGATGCTCACCTGG - Intergenic
1071777329 10:88803923-88803945 AGCCTCTCCTCTTTCTCACCTGG - Intronic
1075468786 10:122672408-122672430 AAAGTCTCCTGGTTCTCTCTGGG + Intergenic
1085041964 11:73331790-73331812 AACCTCTCCCAGCTCTCACCTGG + Intronic
1086407002 11:86507123-86507145 ACCCACTCCTGGTTCTCTCCAGG - Intronic
1089391813 11:118107414-118107436 AATGTCTTCTGGTTCACAGCAGG - Intronic
1091610540 12:2004182-2004204 AACGTCTCCTCCCCCTCACCGGG + Intronic
1096253299 12:50047387-50047409 AATGTCTCCTGGGACACACCTGG - Intergenic
1102555132 12:113721981-113722003 CACGTCTCCTTGTTCTCAGGGGG - Intergenic
1103791744 12:123477005-123477027 AGTCTCTCCTGGTTCTCGCCTGG - Intronic
1104475248 12:129065737-129065759 TCAGTCTCCTGGTTCTCACTAGG + Intergenic
1104542343 12:129677718-129677740 AACGTGTTCTAGTTCTCACCTGG - Intronic
1107675235 13:42789302-42789324 AAGCTCTTCTAGTTCTCACCTGG + Exonic
1108090511 13:46844570-46844592 CAAGTCTCCTGATTCTCACTAGG - Intronic
1108819418 13:54329072-54329094 AACATCTCCTGCTTCTAACGGGG + Intergenic
1113633206 13:111901848-111901870 CACGTCTGCGAGTTCTCACCGGG + Intergenic
1114444077 14:22774604-22774626 AAAGTCTCCTGGTCCTCTTCTGG + Intronic
1115165034 14:30438706-30438728 CAGGTCTCCTGGTTCTGTCCAGG + Intergenic
1116042869 14:39707035-39707057 GATGTTTCCTGGTTCTCATCTGG + Intergenic
1119338422 14:73853795-73853817 TACTTCTCCTAGTTCTAACCAGG - Intronic
1119643060 14:76329209-76329231 CACTTCTCCTTGTTCTCTCCTGG - Intronic
1120310396 14:82819420-82819442 ATCGTCTCATGGTGCTCACATGG - Intergenic
1121945397 14:98116260-98116282 AACTTCGCCTGGGTCTCACCAGG + Intergenic
1123118444 14:105905307-105905329 AACCTGTCCTGGAACTCACCTGG - Intergenic
1123797029 15:23782523-23782545 GACGACTCCTGGTTGTCACAGGG + Intergenic
1125375540 15:39024959-39024981 AATATTTCCTGGGTCTCACCTGG + Intergenic
1125508362 15:40280199-40280221 AACGGCTCCTGCTTCTCGCTGGG - Intronic
1128765814 15:70250573-70250595 AAGGCCTCCTAGGTCTCACCCGG + Intergenic
1131646281 15:94348530-94348552 AACGTCTCCTGGTTCTCACCTGG - Intronic
1132467730 16:85239-85261 ACCATCTCCTGGGTCTGACCTGG - Intronic
1133791624 16:9013459-9013481 TCCGGCTCCTGTTTCTCACCTGG + Intergenic
1136718491 16:32302571-32302593 ACCTTGTCCTGGTTCTCCCCTGG - Intergenic
1136836866 16:33508841-33508863 ACCTTGTCCTGGTTCTCCCCTGG - Intergenic
1138683896 16:58707805-58707827 AACGTGTGCTGTTTCTCACGAGG + Exonic
1140535370 16:75704835-75704857 AGTTTCTCCTTGTTCTCACCTGG + Intronic
1141345440 16:83240466-83240488 AAGTTCTCCTCTTTCTCACCTGG - Intronic
1203007937 16_KI270728v1_random:215194-215216 ACCTTGTCCTGGTTCTCCCCTGG + Intergenic
1203147041 16_KI270728v1_random:1809120-1809142 ACCTTGTCCTGGTTCTCCCCTGG - Intergenic
1143922304 17:10340131-10340153 AAGATCTGCTGGTACTCACCAGG + Exonic
1145266610 17:21382789-21382811 ATTGTCTCCTGGGGCTCACCTGG + Intronic
1148739408 17:49883971-49883993 AAGCCCTCCTGGTTTTCACCAGG + Intergenic
1153642348 18:7167817-7167839 ACCACCCCCTGGTTCTCACCTGG + Intergenic
1153760225 18:8323752-8323774 AGCGTCTCCCTGTTCTCACGTGG - Intronic
1155313499 18:24547819-24547841 AACGGCTCATGGTTCTCCCCAGG - Intergenic
1156528645 18:37793912-37793934 AAAGTCTCCTGGTCCTTAACAGG - Intergenic
1157407729 18:47437482-47437504 AAGGTCTCCTGTCTCTCACCTGG - Intergenic
1160827884 19:1089196-1089218 AACGTCTCCTGCTTCTAAGGTGG + Intronic
1166125785 19:40714768-40714790 AGTTTCTCCTGGTTCTCCCCTGG + Intronic
1166633810 19:44431748-44431770 TAGGCCTCATGGTTCTCACCTGG + Intronic
1168064813 19:53913126-53913148 AACGGATCCTGATTCTCTCCTGG + Intronic
926688716 2:15718104-15718126 AATGTCTCCCGGTTCTGTCCTGG - Intronic
927267246 2:21163683-21163705 CTCGTCACCTGGTTGTCACCTGG + Intergenic
933954339 2:87354023-87354045 AACTTGCCCTGGTTCTCCCCTGG + Intergenic
934274659 2:91566467-91566489 AACTTGCCCTGGTTCTCCCCTGG - Intergenic
938061809 2:128260949-128260971 AACGTTGCCTGGTGCTCCCCGGG + Intronic
939643401 2:144667816-144667838 AATGTGTCCTGGTTCTTACACGG + Intergenic
940159217 2:150693554-150693576 AATGTCTCCTGGTTCCCAATTGG + Intergenic
948253705 2:236551153-236551175 CACTTCTCCTGGTGCTCGCCGGG - Intergenic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
1175543631 20:59763803-59763825 ATACTCTCCTGGTTCTCCCCTGG - Intronic
1181141555 22:20809076-20809098 AACGTCTGGTGGTCCTCACAGGG + Intronic
1183092576 22:35532865-35532887 AACACCTCCTGTTTCTGACCTGG - Intergenic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1184863734 22:47191285-47191307 ACCTTCTGCTGGTTGTCACCAGG - Intergenic
1184956707 22:47892058-47892080 AATGGCTCCTGCTTCTCAGCAGG - Intergenic
952973406 3:38671683-38671705 AACCCCACCTGGTTCTCACAGGG - Intergenic
956698880 3:71941512-71941534 AACGGCTCCTGCTGCTCTCCAGG + Intergenic
963010043 3:140760350-140760372 ATAGTCTCCTGGATCTCAGCTGG + Intergenic
969933554 4:10658448-10658470 TATCTCTCCTGGTTCTCAGCTGG + Intronic
981403000 4:144336721-144336743 AATGTTTCCTGTGTCTCACCTGG + Intergenic
983411451 4:167403463-167403485 AACCTCTCCAGATTGTCACCGGG + Intergenic
1004595342 6:17094201-17094223 AAAGTCTGCTGAGTCTCACCAGG - Intergenic
1005847492 6:29792831-29792853 AACGGCTCCTGGGCCTCTCCCGG - Intergenic
1013389694 6:109671423-109671445 AACCTCTCCTGGTACTCAAATGG - Intronic
1015662926 6:135596160-135596182 AGAGTCTCATGGTTGTCACCAGG - Intergenic
1016367544 6:143336013-143336035 AACTTTCCCTCGTTCTCACCTGG + Intronic
1019685730 7:2380964-2380986 AAAGTCACAGGGTTCTCACCAGG - Intergenic
1020189481 7:5984472-5984494 GACGTTTTCTGGTTCTCACCTGG + Intronic
1020293437 7:6740183-6740205 GACGTTTTCTGGTTCTCACCTGG - Intergenic
1030351400 7:108491915-108491937 AAAGTCTCATTGTCCTCACCTGG - Intronic
1036154213 8:6326779-6326801 TACATCTCCTGGTTTTCTCCTGG + Intergenic
1036642556 8:10593272-10593294 AAGGTCTCCTGGTCCCCACCCGG - Intergenic
1041107036 8:54454088-54454110 AACGTCTCCTCCTTGTCCCCGGG - Intergenic
1049278920 8:141734216-141734238 AATGTCTCCTGGTGCACACGCGG - Intergenic
1056762418 9:89424921-89424943 AAAGCCTCCTGTTTCTCTCCAGG + Intronic
1061959558 9:133981097-133981119 CCCGTCTCCTGCTTCTCCCCAGG - Intronic
1187262390 X:17698430-17698452 AACTTCTTCTGGTTCTCCCATGG - Intronic
1187465750 X:19526149-19526171 AACCCCACCTGGTTCTCACAGGG - Intergenic