ID: 1131647309

View in Genome Browser
Species Human (GRCh38)
Location 15:94359442-94359464
Sequence ATTTAAACACAGATGTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131647308_1131647309 22 Left 1131647308 15:94359397-94359419 CCTTGTGTTCATTCTGTATACAT 0: 1
1: 0
2: 3
3: 24
4: 272
Right 1131647309 15:94359442-94359464 ATTTAAACACAGATGTTGAAAGG 0: 1
1: 0
2: 2
3: 31
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131647309 Original CRISPR ATTTAAACACAGATGTTGAA AGG Intronic
900077760 1:832004-832026 ATTTAAAGCCAGTTCTTGAAGGG - Intergenic
901144814 1:7057709-7057731 ATTTCAACCCAGATGTTGTCAGG - Intronic
901227717 1:7623994-7624016 ATTTAAACACAGTTTTTGAACGG + Intronic
901376039 1:8840268-8840290 ATTTAAAAAAAGAGGTTTAATGG - Intergenic
901377821 1:8852284-8852306 ATTTATACACAAATGTTCAGAGG + Intergenic
903408970 1:23123946-23123968 TTTTAAAGAGAGATGGTGAAAGG - Intronic
904898762 1:33839071-33839093 ATGTAATCACAAATGTTGGAAGG + Intronic
906176089 1:43774113-43774135 ATTCAAACACAGATATATAAGGG + Intronic
906423256 1:45688039-45688061 AGTTGAATCCAGATGTTGAACGG - Exonic
908161229 1:61410384-61410406 AATTAAACACACAGGTTGAGTGG + Intronic
908493911 1:64675179-64675201 ATATATACACAGCTGTTCAATGG + Intronic
909997019 1:82292614-82292636 ATTTAAAAACACAACTTGAAAGG + Intergenic
910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG + Intergenic
910697007 1:90029983-90030005 ACTTGAAAACAGAAGTTGAAAGG - Intronic
910735211 1:90446422-90446444 AATTAATGACAGATTTTGAAGGG - Intergenic
910866983 1:91797738-91797760 AATTAAACACAAATGTTAAATGG - Intronic
911198720 1:95022220-95022242 ATTTTGACACAGATGTTGTTCGG + Intronic
911312825 1:96317048-96317070 ATTGAAATAGATATGTTGAAGGG - Intergenic
911352323 1:96768595-96768617 ATTTAAATACAGTTGTTTGAAGG - Intronic
911717359 1:101148731-101148753 ATTTAAACATAAAAGTTTAAGGG + Intergenic
911901997 1:103518122-103518144 ATCTACATACAGATGCTGAAAGG - Intergenic
912282648 1:108332532-108332554 ATTTAAACTGAGCTGTTGATGGG + Intergenic
913595070 1:120367322-120367344 ATTCATATACATATGTTGAATGG - Intergenic
914306333 1:146422202-146422224 ATTCATATACATATGTTGAATGG - Intergenic
914595717 1:149150601-149150623 ATTCATATACATATGTTGAATGG + Intergenic
914748067 1:150513804-150513826 ATTTATTCACATATTTTGAAAGG + Intergenic
915827849 1:159097649-159097671 ATTTAAACATAGAAGGGGAAGGG - Intronic
916256397 1:162792092-162792114 ATTTAATCATAGTTGTTGAGAGG + Intronic
916920528 1:169461350-169461372 ATTTTAACAGAAATGTGGAAAGG - Intergenic
918635531 1:186769817-186769839 ATTTAGAGATAGATGTTGAGAGG - Intergenic
919004352 1:191875641-191875663 GTTTCAACAAAAATGTTGAAGGG + Intergenic
919143116 1:193598672-193598694 ATTTAAATGCATATCTTGAATGG + Intergenic
919313265 1:195939002-195939024 ATTTAAACCCAGCTGTTGTGAGG - Intergenic
919924893 1:202187123-202187145 ACTTACTCAGAGATGTTGAAGGG - Intergenic
921165933 1:212507204-212507226 ATTTAAACAAATGTATTGAATGG - Intergenic
921318908 1:213918386-213918408 ATTTAAACAAACCTGTTGACTGG - Intergenic
922048907 1:221971749-221971771 CTTTAGATTCAGATGTTGAATGG - Intergenic
923749501 1:236734549-236734571 ATTAAGACACAGAAGGTGAAGGG - Intronic
924098598 1:240580239-240580261 ATTTAAATACAAATTTTTAAAGG + Intronic
924281900 1:242446652-242446674 AGTTAGACACAGCTGTTTAAGGG + Intronic
924482287 1:244447658-244447680 ATATAAACAAAGACTTTGAATGG + Intronic
1063481804 10:6382937-6382959 ATATAAACACAGGTGTGGGAGGG + Intergenic
1064023966 10:11832070-11832092 CCTTAAACACAGATTTTAAAAGG - Intronic
1065158975 10:22899462-22899484 ATTTGAACACAGATGCAGAGAGG + Intergenic
1066722860 10:38357745-38357767 ATTTAATCATAGTTGTTGAGAGG + Intergenic
1067771427 10:49129378-49129400 ATTTGAGCAGAGATGTTGAGTGG - Intergenic
1068778394 10:60892390-60892412 ATACAAACACACATATTGAAGGG - Intronic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1069014243 10:63410239-63410261 ATTTAATCACATATATTGCATGG + Intronic
1071048122 10:81409223-81409245 AGTTACACACAGATGTCAAATGG - Intergenic
1071699388 10:87914007-87914029 ACTTTAAAACAAATGTTGAAAGG - Intronic
1071705010 10:87988389-87988411 ATTTCAACACGAATTTTGAAGGG + Intergenic
1071981913 10:91011930-91011952 ATTTTTTCACAGATGTTGGAAGG - Intergenic
1072001252 10:91197837-91197859 ATTTAAAAACAGACGTTCCAAGG + Intronic
1072126812 10:92453312-92453334 ATATAAACACAGATGATGACTGG - Exonic
1072184898 10:93027893-93027915 ATTTAAAAATACATTTTGAAAGG + Intronic
1072747687 10:97952899-97952921 ATATATTCACAGATGTGGAAGGG - Intronic
1073370633 10:102985766-102985788 ATTTAATGACAGCTGTTCAAGGG + Intronic
1075056329 10:119221385-119221407 CTATAAACACAGATATGGAAAGG - Intronic
1076232735 10:128835219-128835241 ATATACACACAGACCTTGAACGG - Intergenic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1078507674 11:11964829-11964851 ATTTTAAGATAGATGTTGACGGG - Intronic
1078540398 11:12208678-12208700 ATTTAAACAAACATGCTAAAAGG - Intronic
1079617479 11:22513116-22513138 ATTTAAACACAAGTGTTTCAAGG + Intergenic
1079627010 11:22628018-22628040 ATTTAAACAGATAAGTAGAAAGG - Intronic
1079711882 11:23694005-23694027 ATGTTAAAACACATGTTGAAAGG + Intergenic
1079775738 11:24524029-24524051 TCTTAAACAAAGATGTTGAATGG + Intronic
1079776146 11:24530950-24530972 ATTAGAACACAGATGTTATAGGG - Intronic
1080202242 11:29685792-29685814 ATTAAAACACAAAAGATGAAGGG - Intergenic
1081165305 11:39801398-39801420 AGGTAAACACAAATGTGGAATGG + Intergenic
1085674510 11:78503238-78503260 AGTTCAGCACAGATGCTGAATGG + Intronic
1085754033 11:79189114-79189136 ATGTAAACACAGATATGGTATGG + Intronic
1087237792 11:95739377-95739399 ATTAAAAGACAGATGGTGAAGGG - Intergenic
1087238182 11:95744548-95744570 ATTTCAACACGAATTTTGAAAGG - Intergenic
1087419783 11:97907398-97907420 CTTTAAACACAGATGTCAGAAGG + Intergenic
1087437325 11:98138101-98138123 ATTTAAACACATTTGTTAAATGG + Intergenic
1088411017 11:109534772-109534794 ATTTAAAAACAGATCTCTAATGG - Intergenic
1088896590 11:114083227-114083249 TTTTAAAAAAAGAAGTTGAAAGG + Intronic
1089022996 11:115237444-115237466 ACTTCAACACAGCTGTAGAAGGG - Intronic
1090067474 11:123515727-123515749 ATTTAAACACAAAATTTAAAAGG + Intergenic
1090068428 11:123523814-123523836 CTTTCAGCACAGATATTGAAGGG - Intergenic
1090480209 11:127061286-127061308 ATTTAAACCAAGATGAAGAAAGG - Intergenic
1090590743 11:128264673-128264695 ATTTAAACACCAATCCTGAAAGG - Intergenic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1094059549 12:26299257-26299279 TTTTAAAAACAGACGTCGAATGG - Intronic
1094480203 12:30875424-30875446 ATTTAAAAACAGATGGGGAAAGG - Intergenic
1096076508 12:48809052-48809074 ATTTAATCTCAGAAGTGGAAGGG + Intergenic
1096221274 12:49829445-49829467 ATTTAAATACGGAATTTGAAGGG + Intergenic
1097138163 12:56876746-56876768 AGGTAAGCACACATGTTGAAGGG - Intergenic
1097447916 12:59695817-59695839 ATTGAAACAAAGATATTGGATGG + Intronic
1097653569 12:62333661-62333683 ATTAAGAAACAGATGTAGAATGG + Intronic
1098634609 12:72766579-72766601 CTTTAAACACAGGTCCTGAATGG + Intergenic
1098788504 12:74789887-74789909 AATTTAACAAAGATGATGAAAGG - Intergenic
1099148804 12:79082113-79082135 AATTCAACACAGATTTTGGAAGG + Intronic
1099151376 12:79118224-79118246 TTTTAACCACACATGTTAAATGG - Intronic
1099444412 12:82735139-82735161 ATTTAAACATAGATGTTTTGAGG - Intronic
1099771904 12:87070526-87070548 ATATAAACACACATGATGAGAGG - Intergenic
1099909769 12:88815377-88815399 ATTTAAACAAAGATAATGAAAGG - Intergenic
1099925976 12:89017881-89017903 ATTTAAACACATATGATCTAAGG - Intergenic
1099927523 12:89035820-89035842 ATTTATACACAGAGTTTGCAAGG - Intergenic
1100714061 12:97287686-97287708 AGTACAACACAAATGTTGAATGG - Intergenic
1100752216 12:97710931-97710953 GTTTCAACATAAATGTTGAAGGG + Intergenic
1101907855 12:108841002-108841024 ATATAAACACAGATCTAGATTGG + Intronic
1102892324 12:116569648-116569670 ATTTCAACAAAGAAGTAGAATGG + Intergenic
1103053304 12:117799572-117799594 ATTTAATCATAGATGATGCATGG + Intronic
1103687468 12:122743411-122743433 ATATGAACACAGATTTTCAAGGG + Intergenic
1103977037 12:124709700-124709722 ATTAAAAGACAAAAGTTGAACGG + Intergenic
1104496047 12:129240207-129240229 AATTACACACATATGTTAAAAGG - Intronic
1105663402 13:22525083-22525105 ATTTATACCCAGAAGTTGATTGG - Intergenic
1107190337 13:37576417-37576439 ATTAAGACACACATGTTCAATGG - Intronic
1109613799 13:64803413-64803435 TTTTAAACACAGAGGTTGTTAGG + Intergenic
1109665777 13:65534509-65534531 ATTTAAACATAAATGTGGATTGG - Intergenic
1110061322 13:71041492-71041514 ATTTAAACAAAGTTCTTGGAGGG - Intergenic
1110662483 13:78073338-78073360 ATTTAAACAGATATATTGAGTGG - Intergenic
1110682084 13:78326003-78326025 CTTTAAACTCAGAAGGTGAATGG + Intergenic
1111336339 13:86829186-86829208 ATTTATACCCAGATGTAGGATGG + Intergenic
1111802385 13:92996658-92996680 ATTTCAACACACATTTTGGAGGG - Intergenic
1112168518 13:96945859-96945881 ATTTAAACGAAGATGTTGGGTGG - Intergenic
1112359903 13:98708068-98708090 ATATAAACAAAGATATTAAAAGG + Intronic
1113642631 13:111969071-111969093 ATGTAATCACAGATGTTGACTGG + Intergenic
1114912890 14:27222029-27222051 ATTGTAACAAAAATGTTGAAGGG - Intergenic
1115187570 14:30708099-30708121 TTTTAAACATAAATGTTGACAGG + Intronic
1115448665 14:33520790-33520812 GTTTCAACACAGCTGTTGAGTGG + Intronic
1117265704 14:54084362-54084384 ATTTAAAAATAGATTTTTAAGGG - Intergenic
1117326597 14:54674614-54674636 ATTTAAAGACATCTGTAGAAAGG - Intronic
1117675378 14:58150789-58150811 TTTTACACACAGAGGTTTAAAGG - Intronic
1119606418 14:76021952-76021974 GTTTAAACACAAATGTTGGTTGG + Intronic
1119966804 14:78925666-78925688 ATTTAAATATAGTTATTGAAAGG + Intronic
1120152026 14:81047174-81047196 ATTGAAACACACATACTGAAAGG + Intronic
1120383505 14:83813361-83813383 TTTTATACACACATTTTGAAAGG + Intergenic
1122487765 14:102093039-102093061 ATTTAAAAACAGCTGTTGGCTGG - Intronic
1122526891 14:102392864-102392886 ATTCAAACTCTGATGCTGAATGG + Intronic
1124417845 15:29488860-29488882 ATTTACACCCACATATTGAATGG + Intronic
1124820280 15:33038315-33038337 TTTTAAACACAGAAGATGCAGGG - Intronic
1125168403 15:36738246-36738268 ATTCAAGCAGAGGTGTTGAATGG - Intronic
1126247791 15:46529412-46529434 ATTTAAATGCAGATGTGGAATGG + Intergenic
1126301138 15:47197400-47197422 ATTTAAAAACAGAATTTGAGGGG - Intronic
1126323817 15:47453301-47453323 TTTAAAACACATTTGTTGAAAGG - Intronic
1127392397 15:58517147-58517169 ACTCAAACACAATTGTTGAAGGG - Intronic
1128190880 15:65694939-65694961 AATTAAACACAGATCTTAAGAGG + Intronic
1128224788 15:65994147-65994169 AATTAAACACAGACGTTTAAAGG - Intronic
1128781750 15:70362961-70362983 ATTCAAAGACAGGTGTGGAAAGG + Intergenic
1128826683 15:70724439-70724461 ATTAAAACTGAGATGTTTAAAGG - Intronic
1129863890 15:78887544-78887566 ATTTATACACACAAGTTAAAGGG - Intronic
1130450747 15:84049347-84049369 GTTTTAACACAGATATTGGATGG + Intergenic
1130858062 15:87859097-87859119 AGTTCAACAGAGATGTAGAAAGG - Intergenic
1131154459 15:90066407-90066429 ATTTAAAAACTGATTTTAAAAGG - Intronic
1131647309 15:94359442-94359464 ATTTAAACACAGATGTTGAAAGG + Intronic
1132257636 15:100391062-100391084 AATCAAATAAAGATGTTGAATGG + Intergenic
1133399249 16:5472650-5472672 ATTTACAAACAGCTGATGAAAGG - Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1140586642 16:76300561-76300583 TTAAAAACAAAGATGTTGAATGG + Intronic
1142552255 17:748008-748030 ATTTCTTCACAGATGTTCAAGGG + Exonic
1142593746 17:1019620-1019642 ATTTAAACACAGAGGAGGGAGGG + Intronic
1148198890 17:45734786-45734808 ATTGAAACTCAGAGGTAGAAAGG + Intergenic
1148485850 17:47990528-47990550 ATGTCAACACAGAAGTTGATGGG - Intergenic
1148616203 17:49001782-49001804 ATTTAAAAACAGTTGTGGAAAGG + Intronic
1148657880 17:49301883-49301905 CATTTAACACAGAAGTTGAAGGG - Intronic
1148961720 17:51398903-51398925 ATTTCTGCACAGTTGTTGAAAGG - Intergenic
1149253814 17:54801415-54801437 TTTTAAAAACAGCTATTGAAAGG + Intergenic
1149283353 17:55132508-55132530 CTTTAGAAAAAGATGTTGAAAGG - Intronic
1149747392 17:59112458-59112480 ATGTAATCACAGATTTAGAAAGG + Intronic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1153070178 18:1096580-1096602 ATTTGTACACCGATGTTCAAGGG - Intergenic
1153986278 18:10353437-10353459 CCTTATAAACAGATGTTGAAAGG - Intergenic
1154261924 18:12842524-12842546 ATGTAAGCACAGATGTGGAAGGG + Intronic
1154936600 18:21064374-21064396 AATGATACACAGATCTTGAATGG - Intronic
1157201784 18:45665599-45665621 ATTCAAACACAGATTATGCATGG + Intronic
1157979634 18:52366159-52366181 TTTTAAACATAGATGTTTATAGG - Intronic
1158875381 18:61729265-61729287 ATTGAAACACAAATTTTGACTGG - Intergenic
1159395800 18:67854450-67854472 ATATAAACACAGAAGATGAATGG - Intergenic
1160098773 18:75901316-75901338 ATTAAAAACCAGATGGTGAAAGG + Intergenic
1160100156 18:75913059-75913081 TGTCAAACACAGATGTTTAATGG - Intergenic
1160116121 18:76081282-76081304 ATTTAAAGAAAGATATTGTATGG - Intergenic
1160278912 18:77468388-77468410 ATATAAGCACAGATTTGGAAGGG + Intergenic
1163411317 19:17156552-17156574 ATTTAAAAACATATTTTTAAAGG - Intronic
925491389 2:4398841-4398863 ATTAAAAGTCAGATGTTGAGTGG - Intergenic
925603757 2:5636666-5636688 ATTCACATACATATGTTGAATGG - Intergenic
927075899 2:19577211-19577233 ACTGCAACACAGATGTTAAAAGG + Intergenic
928630972 2:33191826-33191848 ATATAAACATAGATGTTTATTGG - Intronic
928897067 2:36278265-36278287 ATTAAACCACAGATGGTTAATGG - Intergenic
929261059 2:39866997-39867019 CTGTAAAAACATATGTTGAATGG + Intergenic
930394957 2:50810304-50810326 ATATGAAAACAGATTTTGAAAGG - Intronic
930636186 2:53808272-53808294 AATTAAACACACACGTTTAAGGG - Intronic
931310990 2:61080413-61080435 TCTTAAACACAAATGGTGAAGGG - Intronic
932012725 2:67994330-67994352 ATTTAAAAAAAGAGGTTTAATGG - Intergenic
932043141 2:68320262-68320284 ATATTTACACAGATTTTGAAGGG + Intergenic
932840304 2:75076023-75076045 ATTTAAACACAGCATATGAATGG + Intronic
932995702 2:76849375-76849397 ATTTGCACAAAGATGTTGCATGG - Intronic
933113671 2:78437769-78437791 ATTTAAAAAAAGAAGTTTAATGG - Intergenic
933124105 2:78582503-78582525 ATTTAAACACTAATTTTTAATGG + Intergenic
937431850 2:121845524-121845546 ATTTAACCAAAGAAATTGAATGG + Intergenic
937933527 2:127223751-127223773 ATTTAAACACACATGGAGACAGG + Intergenic
939092171 2:137792047-137792069 ATTTAAAAAAAGAGGTTTAATGG + Intergenic
940152452 2:150617262-150617284 ATTTAAGCAAAGATTTTGAGTGG + Intergenic
940963436 2:159811418-159811440 AATTAAAAACAGGTGTTAAAGGG - Intronic
941539397 2:166763791-166763813 ATTTAATTACAGATGATGAGAGG - Intergenic
941950163 2:171147457-171147479 ATTTGAGCCCAGAAGTTGAAAGG - Intronic
943036486 2:182752585-182752607 ATTTAAACAAAGATTTCAAAAGG - Intronic
943043897 2:182835321-182835343 ATTTACACACAGAATTTGAAGGG + Intronic
943165506 2:184319092-184319114 ATTTCAACTCAGCTGTTTAATGG + Intergenic
943326110 2:186500053-186500075 ATTATAACACTGATGTTAAAAGG + Intronic
945174975 2:207034766-207034788 ATTTACACATAGAGGTGGAACGG + Intergenic
945535671 2:211014915-211014937 ATTTATACACAGGTATTGCATGG - Intergenic
945906431 2:215598672-215598694 CTTTAAAAACAGATGTTCTACGG - Intergenic
946672210 2:222117031-222117053 GTGAAAACACAAATGTTGAATGG + Intergenic
946808951 2:223501941-223501963 ATTTAAGTGCAGATGTTGCATGG + Intergenic
947701965 2:232242159-232242181 CTTTAAACAGAGATGTTGGCTGG + Intronic
948997077 2:241586738-241586760 AATTAGACACAGATGAAGAAAGG + Intronic
1169677487 20:8170349-8170371 ATTTAAAAACAGAGGTAAAAAGG + Intronic
1169746267 20:8946179-8946201 ATTTAAAAAGAGTAGTTGAAGGG - Intronic
1169796646 20:9469778-9469800 CTTTAGACACAGCTGGTGAAGGG + Intronic
1170346313 20:15390539-15390561 AATTAAACATAGATGCAGAATGG + Intronic
1170386684 20:15826071-15826093 TTATAATCACAGATGTTTAAAGG - Intronic
1170452756 20:16502310-16502332 ATGTATACAGAGATGTTTAATGG + Intronic
1172707038 20:36889463-36889485 TTTGAAACACAGATGGTGAAGGG + Intronic
1174302787 20:49594446-49594468 ATTTAAACACATCTGTGGACGGG + Intergenic
1174823926 20:53751695-53751717 ATTGAAACACAGTTGTAGAAAGG + Intergenic
1175545754 20:59776659-59776681 ATTTAAACACAGAAGAGGATGGG + Intronic
1175579983 20:60090931-60090953 ATTTAAAAACAGAAATTTAAGGG + Intergenic
1177258824 21:18701634-18701656 ATTTAAACATAAATTTTGGAGGG + Intergenic
1177504738 21:22005900-22005922 ATTTAGACACAGATGTACAGAGG + Intergenic
1177904906 21:26963891-26963913 ATGTAAACAAAGATGCTGGAGGG - Intronic
1178448121 21:32663930-32663952 GTCTATACACAGATGATGAAGGG + Intronic
1178865454 21:36323167-36323189 ATTTCCAGACAGATGTTAAAGGG - Intronic
1181235680 22:21446495-21446517 ATTTTGCCACAGATGTTGCAGGG - Exonic
1184843563 22:47066812-47066834 ATTAAAATACAGATGTGGAATGG - Intronic
949314796 3:2740569-2740591 TTTTAAACACAGATCTTCATTGG + Intronic
950039728 3:9912250-9912272 ATTTTTACACAGAGGTTGAAGGG - Intronic
950989597 3:17418719-17418741 ATGTAAATACTGATGTTGTATGG + Intronic
951578027 3:24133485-24133507 ATTTAAATGAAGAAGTTGAAGGG + Intronic
951995068 3:28718420-28718442 CTTTAAACATTGAAGTTGAAGGG + Intergenic
952606486 3:35153517-35153539 ATTTAAAAACTCATGTGGAAGGG - Intergenic
953156123 3:40375708-40375730 ATTTAAAAACAGAAGTTTAATGG - Intergenic
954710228 3:52501838-52501860 AATTAAACAAACAAGTTGAAGGG - Intronic
955176134 3:56614835-56614857 ATTTAAAAATAGATTTTAAAAGG - Intronic
955680527 3:61495853-61495875 ATATAAACAAAGATGTTAATAGG + Intergenic
956502091 3:69897910-69897932 ATTCTTACAAAGATGTTGAATGG + Intronic
957130105 3:76213567-76213589 ATTTAAAAATAGATGTATAAAGG - Intronic
957138891 3:76327629-76327651 ATATAAACACTAATTTTGAATGG + Intronic
957418775 3:79941220-79941242 ATATTAACACATATGTTAAATGG - Intergenic
957964001 3:87298480-87298502 AATTATACAGAGATGATGAAAGG + Intergenic
957964998 3:87310907-87310929 TTTTAAACACAAATTTTTAATGG - Intergenic
958545337 3:95541443-95541465 ATTTAAAAAAAAAAGTTGAAGGG - Intergenic
959186854 3:103056014-103056036 ATTTAAATTCAAATGTTAAATGG + Intergenic
960656814 3:120013871-120013893 ATTAAAACAAAGATGTTGGCCGG + Intronic
960882585 3:122360800-122360822 ATCTAAACACAGAGGTTGTGAGG + Intronic
962170436 3:133095967-133095989 ATTAAAACGCTGCTGTTGAATGG - Intronic
962451823 3:135525469-135525491 ATTTAAAGATAGAGGTAGAATGG - Intergenic
963553714 3:146758960-146758982 ATTTCAACATGGAAGTTGAAGGG - Intergenic
963582999 3:147150380-147150402 GTATATACCCAGATGTTGAATGG - Intergenic
963704512 3:148669368-148669390 ATTTGAACACAGATGTAGGTAGG - Intergenic
963814534 3:149814356-149814378 ATTTAAGCACAGTTTTTTAATGG + Intronic
964215513 3:154276110-154276132 ATTTAAACAATGATGAAGAATGG + Exonic
965028599 3:163334684-163334706 AAATAAAAAAAGATGTTGAATGG + Intergenic
965290839 3:166877537-166877559 TTTTAAAGACAGTTTTTGAAAGG - Intergenic
965483525 3:169249580-169249602 ATTTAAAAACAGATTTTTTAAGG - Intronic
968265795 3:197362532-197362554 AAAGAAATACAGATGTTGAAAGG - Intergenic
969081655 4:4623486-4623508 ATTTAAAAAAAGAGGTTTAACGG - Intergenic
969142021 4:5084105-5084127 ATTTAAATACAGAGATTGGAGGG - Intronic
970303262 4:14703593-14703615 ATTAAAACACAAATACTGAAAGG + Intergenic
970331428 4:14988812-14988834 ATTCAAATACATAAGTTGAAAGG + Intergenic
970403317 4:15738538-15738560 ATTTAAAAATATATGTTGGAAGG + Intergenic
972047528 4:34686237-34686259 ATTTCAACATAAATTTTGAAGGG + Intergenic
972798131 4:42443424-42443446 ATTTAAAAACAGCTTTTAAATGG + Intronic
972893683 4:43592207-43592229 ATTTAAAAACAAATCTTAAAAGG + Intergenic
974286167 4:59870305-59870327 ATCTTAACACAGATGTCTAAAGG + Intergenic
975169725 4:71219582-71219604 ATTTAAAAACACATTTTGTAAGG + Intronic
975441204 4:74412935-74412957 ATTGAAGCACAGATGTGCAATGG + Intergenic
976361972 4:84190345-84190367 ATTGAAACCCAGAAATTGAAGGG + Intergenic
976519622 4:86011321-86011343 TTTTCTCCACAGATGTTGAAAGG - Intergenic
976555502 4:86446596-86446618 ATTTAATCACAGGTCTTCAAAGG + Intronic
977665827 4:99646414-99646436 ATGGAAACACAGATGGTTAATGG + Intronic
978668506 4:111216184-111216206 GTCTAAATACTGATGTTGAATGG + Intergenic
980130734 4:128813185-128813207 ATTTAATCACAGGTGGAGAAAGG + Intronic
980183984 4:129438251-129438273 ATTTAAAAAGTGATATTGAATGG - Intergenic
980346469 4:131627996-131628018 ATTTGAAGTCAGATGTTCAAGGG - Intergenic
980658495 4:135823721-135823743 ATTTAACCACAGATTTTTGAAGG - Intergenic
980795557 4:137677962-137677984 ATCTAAAAAATGATGTTGAAAGG - Intergenic
980868576 4:138583510-138583532 GTTATAACACAGATGTGGAAGGG - Intergenic
981411019 4:144432222-144432244 ATTTAAACAGATATGAGGAATGG - Intergenic
981883954 4:149650371-149650393 ATTGAAACAAAGGTGTTGGAAGG - Intergenic
982426881 4:155274485-155274507 ATTAAAACACAGAGTTTGAGAGG - Intergenic
983263574 4:165484018-165484040 ATATAAAACCAGATATTGAATGG + Intronic
983922325 4:173359329-173359351 AGCTAAACACAGACGTTGATTGG - Intergenic
983929109 4:173433994-173434016 AGTTTATTACAGATGTTGAAAGG - Intergenic
984238479 4:177190439-177190461 ATTAAAACAAAGATTTAGAATGG + Intergenic
984278933 4:177643830-177643852 AGTTGAAGACAGATGGTGAATGG - Intergenic
984750342 4:183266768-183266790 ATTTAAAAAGAGCTGTTGAGGGG + Intronic
985339872 4:188939135-188939157 ATTTAAACACAGTTGTATTATGG - Intergenic
986319441 5:6616138-6616160 ATATACACTCAGAAGTTGAATGG - Intronic
986395750 5:7328186-7328208 ATTTAAAAACATTTTTTGAAAGG - Intergenic
986511043 5:8506516-8506538 ATTTTAAAAAAGAGGTTGAATGG - Intergenic
987095379 5:14545158-14545180 ATTTAAACACACATGGTTCATGG + Intergenic
987544190 5:19291050-19291072 ACTTAAACACAGGCATTGAATGG + Intergenic
987668429 5:20975798-20975820 ATTTGAACACAAATGTTGTTTGG - Intergenic
988042057 5:25902180-25902202 AATTAGAGGCAGATGTTGAAGGG + Intergenic
988158171 5:27481824-27481846 ATTTAAACACATATTTTGATGGG - Intergenic
989786533 5:45338671-45338693 AGTGAAACACAGCTTTTGAAAGG + Intronic
989803069 5:45568869-45568891 ATAAAATCACAGAAGTTGAAAGG + Intronic
990014033 5:51036196-51036218 ATTAAAAAACAAAAGTTGAAGGG + Intergenic
990282406 5:54265192-54265214 ATTAAAGCAAAAATGTTGAAAGG - Intronic
991068934 5:62455638-62455660 ATTTTAACACAGAGGAGGAAAGG - Intronic
991173918 5:63663103-63663125 ATTTAAATAAAGCTGTTGAGAGG + Intergenic
991721210 5:69495345-69495367 ATTAAAACACAGATTCTGATTGG + Intronic
992727285 5:79620961-79620983 ATTTAAAAACAGAACTTGAGAGG + Intronic
993189561 5:84664036-84664058 ATTTAGTCACAGATGGTAAATGG - Intergenic
993452250 5:88086567-88086589 ATTTAAAAATAGATGTCAAAGGG - Intergenic
993700977 5:91118945-91118967 AATAGAAAACAGATGTTGAAAGG - Intronic
993843826 5:92914715-92914737 ATTTAAAGGCTGATGTAGAATGG + Intergenic
994154192 5:96484393-96484415 ATTTAAAAACAGATGTAGAAGGG - Intergenic
994294188 5:98069199-98069221 AATAATACACAGAGGTTGAAGGG + Intergenic
994658362 5:102622304-102622326 ATTTAGAGACAGATGTTCAGGGG + Intergenic
994871433 5:105354370-105354392 ATTTAAACGCTGCTGATGAATGG - Intergenic
994900816 5:105767022-105767044 CTTTCAACATAGAAGTTGAAAGG + Intergenic
995031614 5:107488088-107488110 TTTAAAACACAAATGTTGAGAGG + Intronic
996068535 5:119107900-119107922 GTTTAAATACAGTTGTTGTAAGG - Intronic
996219125 5:120908279-120908301 ATTGAAACACAGATATTTAGTGG - Intergenic
996744720 5:126837040-126837062 CTTTAAAAACAGATTTTGAGGGG + Intergenic
996750566 5:126884479-126884501 ATCTAAGCAGAGATGTTGACTGG - Intronic
997039786 5:130238649-130238671 TTATAAACACAGAATTTGAAAGG - Intergenic
997492653 5:134291223-134291245 ATTTTAATATAGCTGTTGAATGG + Intronic
997708310 5:135979766-135979788 AATCAAACACAACTGTTGAAAGG - Intergenic
997974719 5:138434034-138434056 ATGTAAACACCAATGTTGGACGG - Intronic
998537359 5:142946617-142946639 ATTTAAAAACACATGTTGACAGG + Intronic
998681493 5:144472926-144472948 ATTTGAATACAGATCTTGCAAGG - Intronic
998684136 5:144505014-144505036 ATCTAAAAGCACATGTTGAAAGG - Intergenic
999082489 5:148857287-148857309 AAATAAACTCAGATCTTGAAAGG - Intergenic
1000166970 5:158659543-158659565 ATTTAAAAAGACATATTGAATGG + Intergenic
1000335172 5:160236655-160236677 ATTTAAACAAAAATGTTAAAGGG - Intronic
1000739039 5:164941985-164942007 ATTTAGACACACATGTTCATTGG - Intergenic
1001660960 5:173392869-173392891 TTTTAAATACTGATGATGAAAGG + Intergenic
1002040789 5:176512633-176512655 ATTTAAACCCAAATGTTGGCCGG - Intergenic
1002548173 5:179966487-179966509 ATTTAAAGGGAGATGTTGGAAGG - Intronic
1002801447 6:525741-525763 ATGTATACACATATCTTGAAAGG - Intronic
1003288289 6:4754392-4754414 ATTTATAAACAGACATTGAAGGG + Intronic
1004025718 6:11816653-11816675 ATATATAAACAGATCTTGAAAGG - Intergenic
1004269445 6:14180745-14180767 ATTTAAACACAGCTGTCTGATGG + Intergenic
1004982778 6:21045099-21045121 GTTTCAACATAGATTTTGAATGG + Intronic
1007201193 6:40110713-40110735 ATTGAGACACAGATGCTTAAAGG + Intergenic
1007470240 6:42085428-42085450 ATTTTAACATAAATGTTGAGGGG - Intronic
1008031636 6:46702198-46702220 ATTTAAACACTGTATTTGAAAGG - Exonic
1008202903 6:48614539-48614561 ATTTAAACAGAGATTTGAAAGGG - Intergenic
1008622191 6:53281518-53281540 ATTCAAAAACAGATGAAGAAGGG - Intronic
1009272528 6:61631964-61631986 ATGTAAATATAGATTTTGAAAGG + Intergenic
1009535058 6:64871819-64871841 ATTAAATCTCAGATGTTTAAAGG + Intronic
1009947386 6:70355768-70355790 ATTTTAACATAAATTTTGAAGGG - Intergenic
1009962257 6:70537975-70537997 ATTTGAACAAATATATTGAAAGG + Intronic
1011089454 6:83579790-83579812 ATTTGAGCAAAGATTTTGAAGGG - Intronic
1011372327 6:86650524-86650546 TTTTAAAAAAAGATGTTTAATGG - Intergenic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1012063885 6:94522394-94522416 ATTTCAACACTGAAGATGAATGG - Intergenic
1012351002 6:98250078-98250100 ATTTAGATACATATGTAGAAAGG - Intergenic
1012842965 6:104353386-104353408 ATTTAAGCACAGGTGTTTAATGG - Intergenic
1013669579 6:112385217-112385239 ATTTTCACTCAGAAGTTGAACGG + Intergenic
1013710317 6:112889252-112889274 ATCTAAGCAGAGATGTTGACTGG - Intergenic
1014213327 6:118729722-118729744 ATTTAAAAATATTTGTTGAATGG + Intergenic
1014729771 6:125019229-125019251 ATTGAAAAACAGATGATGACAGG - Intronic
1015246813 6:131084227-131084249 ATTTAAAAACAAAAGCTGAAAGG + Intergenic
1015413743 6:132924549-132924571 ATTTCAAAACAGATATTTAAAGG + Intergenic
1015436303 6:133193207-133193229 ATTTCAACACAAATTTTGGAGGG - Intergenic
1016102995 6:140126604-140126626 ATGGAAGTACAGATGTTGAATGG + Intergenic
1016242627 6:141949122-141949144 ATTAAAAGACAGATGATAAAAGG + Intergenic
1016754867 6:147674007-147674029 ATTTATTCACAGTTGTTCAATGG + Intronic
1018280680 6:162182225-162182247 CATTAAACACAGATGTTGCCTGG + Intronic
1018498553 6:164377541-164377563 ATTTCAAAACAGATGCGGAAGGG - Intergenic
1018564209 6:165134799-165134821 ATTATGACACAGATGTTGGAAGG - Intergenic
1018994407 6:168700322-168700344 ATTTAAACACTGAAAATGAATGG - Intergenic
1020508885 7:9027455-9027477 ATTGAAATACATATATTGAATGG + Intergenic
1020736871 7:11961127-11961149 ATTTTAACCCAGATTTTGACTGG - Intergenic
1020924465 7:14308226-14308248 ATTTAACCTCAGATTTTTAATGG + Intronic
1021080291 7:16356678-16356700 AATTTAAGACAGATGTGGAAAGG - Intronic
1021314152 7:19125384-19125406 ATTTTAACACATATTTTAAATGG + Intergenic
1021743406 7:23711444-23711466 ATTAAAACACAGATTTTTTATGG - Intronic
1023153582 7:37225342-37225364 ATTTCAACACATATATTGTAAGG + Intronic
1023662668 7:42486537-42486559 ATTTAAACATGGATGTTGATAGG - Intergenic
1024062605 7:45710148-45710170 CTGTAATCACAGATATTGAAAGG + Intronic
1024300388 7:47883017-47883039 AATAAAACACAAATGTTGTAAGG + Intronic
1026412882 7:70143773-70143795 ATATAATCACAGATTTGGAATGG + Intronic
1026499257 7:70929058-70929080 ATTTTAACACATATGTAGATTGG + Intergenic
1027009200 7:74727629-74727651 ATTTAAAAACAAATGTGGTATGG - Intronic
1028402890 7:90443417-90443439 TTTTAAACTCAGATGATGTAAGG + Intronic
1028906266 7:96157501-96157523 TTTTAAAAACAGATTTTTAAGGG + Intronic
1028955813 7:96688426-96688448 TTTAAAACACAGGTTTTGAAAGG + Exonic
1029894241 7:103965190-103965212 ATTTAAAAATAGATGTTATAAGG - Intronic
1030110293 7:106021130-106021152 TTTTAAAGACAGAAGATGAATGG - Intronic
1030566560 7:111164763-111164785 ATTCAAACAAAGATCTTGGAAGG + Intronic
1031012521 7:116538751-116538773 ATTTAAAAAAAGAGGTTTAATGG + Intronic
1031944219 7:127821688-127821710 TTTTAAAAATAGATGTAGAAAGG + Intronic
1032459668 7:132101372-132101394 ATTTAAAAAAAGAGGTTTAATGG + Intergenic
1032952226 7:136927791-136927813 ATTTAAATATAGGTATTGAAGGG + Intronic
1033706061 7:143885782-143885804 ATATAAACACAGAAATTGTATGG + Intronic
1033714663 7:143987388-143987410 GTTTAAAGACAGATTTTGAATGG + Intergenic
1033845213 7:145423873-145423895 ATTTCAACACAAGTTTTGAAGGG - Intergenic
1035527861 8:327633-327655 ATTTAAAGCCAGTTCTTGAAGGG + Intergenic
1035816929 8:2551285-2551307 GTTTAAAAACAGTTATTGAAAGG + Intergenic
1036021480 8:4851792-4851814 ATTTAATCACACAAGTTAAAGGG - Intronic
1036197853 8:6736337-6736359 TTTAAAACACTGAAGTTGAATGG - Intronic
1037394626 8:18428971-18428993 ATTTAAAAACAGAGGTTTAATGG - Intergenic
1037997066 8:23360511-23360533 ATTTAAGCCCAGAAGTTGCATGG + Intronic
1038051053 8:23811881-23811903 ATTAATACACAGATGTTGGATGG + Intergenic
1039159140 8:34597118-34597140 ATTTTAACATAGATTTGGAAAGG + Intergenic
1039695799 8:39909820-39909842 ATTCAAAGACAGATTTTGATAGG - Intronic
1039901666 8:41757210-41757232 AATTAAACACACATTTTTAATGG + Intronic
1040726588 8:50387993-50388015 TGTTAAACACAGACGTTGATTGG - Intronic
1041359318 8:57034594-57034616 ATTTAAAAACAGATTTTGTGTGG + Intergenic
1041411131 8:57556851-57556873 ATTAAAACACAAAGGTTGCAAGG - Intergenic
1041650330 8:60295923-60295945 AATTTAACACAGATTATGAAAGG + Intergenic
1042751244 8:72160214-72160236 GTTTCAACACAAATTTTGAATGG + Intergenic
1042797239 8:72677748-72677770 ATTGAAATACAAATGTTTAAGGG - Intronic
1042880202 8:73479239-73479261 ATTTGAACACTGATGTTTGATGG - Intronic
1043274837 8:78379948-78379970 ATTTAAACATGACTGTTGAAAGG + Intergenic
1043478902 8:80632713-80632735 AGGTAACCACAGATTTTGAAAGG - Exonic
1044200912 8:89435006-89435028 CTGTAAACAAAGATGTCGAAAGG + Intergenic
1045937576 8:107698631-107698653 GTATAAACACAAATGGTGAAAGG + Intergenic
1045980119 8:108175226-108175248 ATGTAAACAAAGATTTAGAAAGG - Intergenic
1046228497 8:111319238-111319260 ATTGAAACACAGTTGGTGAGCGG + Intergenic
1046291857 8:112172661-112172683 ATAAAAATACAGATGATGAAAGG - Intergenic
1047166070 8:122439854-122439876 ATTTCAATGCAGATGTTGATGGG + Intergenic
1047888403 8:129279003-129279025 AGATAAACACAGATGCTGAGTGG + Intergenic
1048199726 8:132362252-132362274 ATCTAAACTAAGATGTAGAAAGG - Intronic
1048939350 8:139384933-139384955 ATTTAAACACACAGATTGGAAGG - Intergenic
1053339045 9:37306409-37306431 AGTTATATACAGATGTTTAATGG + Intronic
1053369222 9:37546475-37546497 AATTAAACACAGAAGTTAAGTGG - Intronic
1053376221 9:37608969-37608991 ATCCAAACAGAGATGTTGAGTGG - Intronic
1054826626 9:69580048-69580070 ATTTAACAACAGATGTTTACTGG + Intronic
1055170460 9:73252403-73252425 ATTTCAACAAAGATATAGAAGGG + Intergenic
1056017558 9:82406653-82406675 AATTAATAACAGATGTTAAATGG - Intergenic
1056224495 9:84482060-84482082 ATTTTAACAAACATGTTGACTGG + Intergenic
1056656344 9:88512617-88512639 CTATAAACAAAGATGTTCAAAGG - Intergenic
1057075514 9:92136304-92136326 ACTTACTCAGAGATGTTGAAGGG - Intergenic
1057828587 9:98390025-98390047 TTTTAAACCCAGATGTTCAGGGG - Intronic
1058165802 9:101617558-101617580 ATTTAAACAGAAATTTTAAAGGG - Intronic
1059538112 9:115102624-115102646 ATTTAAAAAAAGATTTGGAATGG + Intronic
1060445696 9:123685487-123685509 ATATAAGCACAGATGTTTTATGG - Intronic
1060473070 9:123964815-123964837 ATTTCAACACTGAGATTGAAGGG - Intergenic
1060711124 9:125865101-125865123 ATTTAAATACTGATGTGGCATGG - Intronic
1185654818 X:1676451-1676473 ATGTAAACACACATGTAGATAGG - Intergenic
1185869085 X:3649023-3649045 GTTTAAAGACAGATGTATAAAGG + Intronic
1186236849 X:7521314-7521336 ATTTCAACACAAGTTTTGAAGGG + Intergenic
1186591259 X:10932156-10932178 AATTAAACACAGATGTTTGGCGG + Intergenic
1187221779 X:17334240-17334262 ATGTCAACACAAATTTTGAAGGG + Intergenic
1187350581 X:18511900-18511922 ATTTGAATCCAGATTTTGAAGGG + Intronic
1188365542 X:29310407-29310429 ATTAAAACACAAATTTTGAAAGG + Intronic
1188475934 X:30592191-30592213 ATTTAAGCGGAGATGTTGAAGGG - Intergenic
1188825360 X:34825518-34825540 ATTTCAACACAGAGCTTAAAAGG + Intergenic
1188873927 X:35406673-35406695 ATTTAAGCAAAGATTTGGAAAGG - Intergenic
1192830888 X:74749887-74749909 GGTTAAACAATGATGTTGAATGG + Intronic
1193751979 X:85356988-85357010 ATGTAACCACAAAGGTTGAAGGG - Intronic
1194666198 X:96680280-96680302 TTTTAAAAACACATGGTGAAAGG - Intergenic
1195089268 X:101442815-101442837 ATTTCAACACAAATTTTGGAGGG - Intronic
1195845824 X:109227292-109227314 ATTAAAAGACAGATAGTGAAAGG + Intergenic
1195981836 X:110586892-110586914 AATTATAAACAGATGTTCAAAGG + Intergenic
1196285567 X:113875471-113875493 AGTTAAAGTCAGATTTTGAAAGG - Intergenic
1197300377 X:124772713-124772735 ATTAAAAAGCTGATGTTGAAAGG + Intronic
1197505144 X:127292779-127292801 ATCTTACCACAGATCTTGAATGG - Intergenic
1197590739 X:128406923-128406945 ATTTAAAAACAGGTGTAGATTGG + Intergenic
1198607151 X:138354110-138354132 ATGTTAACACAGTTGTTGAAAGG + Intergenic
1199613433 X:149636446-149636468 ATTTAATAACAGATTTTCAAGGG + Intergenic