ID: 1131650974

View in Genome Browser
Species Human (GRCh38)
Location 15:94399427-94399449
Sequence GGGAATAAACTGAGGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 417}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131650974_1131650983 19 Left 1131650974 15:94399427-94399449 CCTCTGACCCTCAGTTTATTCCC 0: 1
1: 0
2: 5
3: 30
4: 417
Right 1131650983 15:94399469-94399491 GGCTCATTGACTTATTTTTCCGG 0: 1
1: 0
2: 0
3: 15
4: 176
1131650974_1131650984 20 Left 1131650974 15:94399427-94399449 CCTCTGACCCTCAGTTTATTCCC 0: 1
1: 0
2: 5
3: 30
4: 417
Right 1131650984 15:94399470-94399492 GCTCATTGACTTATTTTTCCGGG 0: 1
1: 0
2: 1
3: 21
4: 184
1131650974_1131650982 -2 Left 1131650974 15:94399427-94399449 CCTCTGACCCTCAGTTTATTCCC 0: 1
1: 0
2: 5
3: 30
4: 417
Right 1131650982 15:94399448-94399470 CCTGTAAAATGGGGCTAAAATGG 0: 1
1: 1
2: 4
3: 65
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131650974 Original CRISPR GGGAATAAACTGAGGGTCAG AGG (reversed) Intronic
900006613 1:59619-59641 GAGAATAAAAGAAGGGTCAGGGG - Intergenic
902986939 1:20160641-20160663 GGGAGGAAACTGAGGCCCAGAGG + Intergenic
903165781 1:21519494-21519516 GGGAGAAAACTGAAGCTCAGAGG + Intronic
903212896 1:21828679-21828701 AGGAGGAAACTGAGGCTCAGAGG + Intronic
903384524 1:22917659-22917681 GGGGGGAAACTGAGGCTCAGGGG + Intergenic
903470081 1:23580738-23580760 AGGAAGAAACTGAGGCTCAGGGG - Intergenic
903481373 1:23655924-23655946 AGGAGGAAACTGAGGCTCAGAGG + Intergenic
903882507 1:26521112-26521134 AGGCACAAACTGAGGCTCAGAGG + Intergenic
904007340 1:27370327-27370349 AGGAGGAAACTGAGGCTCAGTGG + Intronic
904046333 1:27611266-27611288 GTGAGAAAACTGAGGCTCAGGGG - Intergenic
904417748 1:30373462-30373484 GGGAGGAGACTGAGGCTCAGAGG - Intergenic
904606491 1:31700784-31700806 GAGAAGAGACTGAGGGTCTGAGG + Intronic
904809453 1:33153692-33153714 AGGAAGAAACTGAAGTTCAGAGG + Intronic
905345201 1:37306578-37306600 AGGAGAAAACTGAGGTTCAGTGG + Intergenic
906079122 1:43071968-43071990 GTGGAGAAACTGAGGCTCAGAGG + Intergenic
906290445 1:44616463-44616485 AGGAAGAAACTGAGGTGCAGAGG + Intronic
907489036 1:54797105-54797127 AGGAGGAAACTGAGGCTCAGAGG + Intronic
908562707 1:65323166-65323188 AGGAGGAAACTGAGGCTCAGAGG - Intronic
908969687 1:69812350-69812372 ATGAAGAAACTGAGGCTCAGAGG - Intronic
909139347 1:71844082-71844104 GGGAATAAAATTAGGTTAAGGGG + Intronic
909302867 1:74036348-74036370 GGTAATAAACTGGGGATGAGGGG - Intronic
910191169 1:84597391-84597413 GAGATGAAACTGAGGGTGAGAGG - Intergenic
913023430 1:114810072-114810094 GAGAAGAAACTGGGGGTCTGAGG + Intergenic
914448251 1:147768784-147768806 ATGAAAAAACTGAGGCTCAGAGG + Intronic
915476580 1:156156156-156156178 GGAAATAAAGTGAGGCACAGTGG - Intronic
915901706 1:159851442-159851464 ATGAATAAACTGAGGCTCAGAGG - Intronic
916188474 1:162156296-162156318 TAGATTAAACTGAGGCTCAGAGG + Intronic
917740677 1:177959325-177959347 GGGACAAAGCTGAGGCTCAGAGG - Intronic
918305478 1:183242041-183242063 AGGACTGAACTGAGGCTCAGAGG + Intronic
918321185 1:183366276-183366298 GGGAAGAAAATGAGGCACAGAGG - Intronic
919232259 1:194789314-194789336 GAGAAAAAAGTGAGAGTCAGTGG - Intergenic
920255304 1:204650453-204650475 AGGGAGAGACTGAGGGTCAGGGG + Intronic
922235832 1:223721795-223721817 AAGAAGAAACTGAGGCTCAGAGG - Intronic
922599235 1:226837049-226837071 GGGAAAAAACTTAGGGTCTATGG - Intergenic
922728653 1:227938847-227938869 GGCAAGAAACTGAGGTTCAGGGG + Intronic
923284407 1:232478358-232478380 GAGAAGAGACTGGGGGTCAGAGG + Intronic
924474387 1:244370410-244370432 GATAAGAAACTGAGGCTCAGGGG - Intronic
924812136 1:247412457-247412479 GGAAATAAAATGACGGTCAAAGG - Intergenic
1063625421 10:7685218-7685240 GAGCATAAACTGAGGAACAGAGG - Intergenic
1063738089 10:8784935-8784957 GGGTATAAAATGAGCATCAGGGG + Intergenic
1065472135 10:26092944-26092966 GGGAATATACTGATCTTCAGCGG - Intronic
1065858032 10:29846361-29846383 TGGGAAAAACTGAGGCTCAGAGG - Intergenic
1066480963 10:35795143-35795165 GAGACTAAACTGAGATTCAGCGG + Intergenic
1066629406 10:37444332-37444354 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1067471983 10:46544171-46544193 GGGAAGTGACTGAGGGTCAGGGG - Intergenic
1067494759 10:46751810-46751832 GCGATGAAACTGAGGCTCAGGGG + Intergenic
1067599896 10:47588587-47588609 GCGATGAAACTGAGGCTCAGGGG - Intergenic
1067832655 10:49619387-49619409 AGGAAGAAACTGAGGCACAGAGG + Intronic
1070741944 10:78909032-78909054 GGGAAGAAACTGAGGCTCGGTGG - Intergenic
1071016015 10:80997944-80997966 TGGAATAGACTGAGATTCAGAGG + Intergenic
1071651431 10:87396470-87396492 GTGATGAAACTGAGGCTCAGGGG - Intergenic
1072273402 10:93799609-93799631 GGAAAGAAACTGAGGCTCAGAGG - Intergenic
1072315209 10:94195896-94195918 GGGCAGAAACTGATGTTCAGAGG - Intronic
1073964541 10:108973658-108973680 GTGAATCAACTGAGGCTGAGAGG + Intergenic
1074189585 10:111124245-111124267 AGGAGGAAACTGAGGCTCAGAGG + Intergenic
1074753647 10:116609419-116609441 GGGAGGAAACTGAGGCCCAGAGG + Intergenic
1074908333 10:117884413-117884435 GGGAAGAAACTCAGGCACAGGGG - Intergenic
1075104280 10:119527634-119527656 GGGGGTAAACTGAGGCTCGGAGG + Intronic
1075256524 10:120929967-120929989 GTGAGTAAACTGAGGCACAGAGG - Intergenic
1075599055 10:123753803-123753825 TTGGATAATCTGAGGGTCAGAGG - Intronic
1077633151 11:3824522-3824544 GGGAACAAACTGAGGGTGGTTGG + Intronic
1077992558 11:7424986-7425008 GGGTATAAACTTAGAGTCAAAGG + Intronic
1077994949 11:7445084-7445106 TGGAATAACCTGAGGTTTAGAGG - Intronic
1078780635 11:14435743-14435765 GGGAATAGAGTGAGGGTTGGAGG + Intergenic
1079475131 11:20822127-20822149 AAGAGTAGACTGAGGGTCAGGGG + Intronic
1080052903 11:27874865-27874887 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1080237546 11:30089387-30089409 TGGTATAAACTCTGGGTCAGTGG + Intergenic
1080643550 11:34172672-34172694 ATGAAGAAGCTGAGGGTCAGAGG - Intronic
1080746715 11:35114970-35114992 ATGAGTAAACTGAGGCTCAGGGG + Intergenic
1081658879 11:44875729-44875751 GGCAAAAAACTGAGGCTCACAGG - Intronic
1081840494 11:46197645-46197667 GTGAATGAACTGAGCCTCAGAGG + Intergenic
1083333374 11:61909393-61909415 AGGGAGAAACTGAGGCTCAGGGG - Intronic
1083601249 11:63949608-63949630 GGGGATAAACTGGGGCTCTGGGG + Intronic
1083628303 11:64083071-64083093 GTGAGGAAACTGAGGCTCAGGGG + Intronic
1083639544 11:64138086-64138108 GTGAGGAAACTGAGGTTCAGGGG + Intronic
1084207729 11:67605731-67605753 ACGAAAAAACTGAGGCTCAGGGG - Intronic
1084219975 11:67671840-67671862 GTGAATAAAATGAGAGGCAGGGG - Intronic
1084561168 11:69906221-69906243 GTGAGGAAACTGAGGCTCAGAGG - Intergenic
1084968823 11:72758403-72758425 GGAAGGAAACTGAGGGCCAGTGG + Intronic
1086094671 11:83038424-83038446 AGAAATAAACTGAGATTCAGAGG - Intronic
1086108500 11:83173135-83173157 GGGAAAAAACTGAACCTCAGGGG - Intronic
1086169210 11:83816479-83816501 GAAAAAAAACTGAGGTTCAGAGG - Intronic
1088113308 11:106286932-106286954 GGGATCAAACTGAGGCTCTGAGG + Intergenic
1089112398 11:116067183-116067205 GTGACAAAACTGAGGCTCAGAGG - Intergenic
1089340138 11:117751714-117751736 GGGAAAAAATGGAGGCTCAGGGG + Intronic
1089655126 11:119941664-119941686 GTAATTAAACTGAGGATCAGAGG + Intergenic
1090087650 11:123664892-123664914 CTGAAGAAACTGAGGCTCAGAGG - Intergenic
1090347219 11:126081219-126081241 TGGAACAGACTGAGGCTCAGTGG - Intergenic
1090650251 11:128799989-128800011 GGGAAGAAACTGCAGGTGAGCGG - Intronic
1090826903 11:130393914-130393936 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1090998718 11:131890221-131890243 GGGAAGTCTCTGAGGGTCAGGGG - Intronic
1091028864 11:132165619-132165641 GTGAGGAAACTGAGGCTCAGGGG + Intronic
1091644561 12:2264006-2264028 GGGATTAAGCTCAGGGTTAGAGG - Intronic
1091685030 12:2555471-2555493 GGGAAGACACTGAAGGTCTGGGG + Intronic
1091845451 12:3652932-3652954 AGGAGGAAACTGAGGTTCAGAGG - Intronic
1093728659 12:22543969-22543991 GGGAATAGGCTGAGGGGCTGGGG + Intronic
1094204054 12:27821929-27821951 GTAAAGAAACTGAGGCTCAGAGG - Intergenic
1094425803 12:30315993-30316015 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1096189123 12:49603515-49603537 GGAAGGAAACTGAGGCTCAGGGG - Intronic
1096247248 12:49998484-49998506 GCAAATTAACTGAGGCTCAGAGG - Intronic
1096470367 12:51871794-51871816 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1096526903 12:52215422-52215444 GGGAGTGCACTGAGGGTGAGTGG + Intergenic
1097266056 12:57745459-57745481 TGGAAGAAACTGAGGTTCACAGG - Intronic
1097281977 12:57850602-57850624 GGGAACCAAGTGAGAGTCAGTGG - Intergenic
1097381437 12:58899941-58899963 GGAAATAAACTGAGGGCTGGGGG + Intronic
1097689797 12:62724103-62724125 GGTAATAAACTCAGGGGTAGGGG - Intronic
1098616359 12:72529422-72529444 GGGAATAGAGGGAGGGACAGGGG - Intronic
1098763487 12:74454419-74454441 GAGGAAAAACTCAGGGTCAGGGG + Intergenic
1099563933 12:84216374-84216396 GAGAATAAATTGAGCATCAGAGG + Intergenic
1099712712 12:86247691-86247713 TGGCATAAACTAAGGCTCAGTGG + Intronic
1101095644 12:101337096-101337118 GTGATGAAACTGAGGCTCAGAGG - Intronic
1101337894 12:103812953-103812975 GGGAGAAAACTGAGGTCCAGAGG + Intronic
1101832701 12:108271743-108271765 TGGAGGAAACTGAGGTTCAGAGG + Intergenic
1101965170 12:109277446-109277468 ATGAAGAAACTGAGGCTCAGGGG - Intergenic
1101966865 12:109287755-109287777 GTGAGTAAACTGAGGCTCAGAGG + Intronic
1102440747 12:112962488-112962510 GTGGGTAAACTGAGGTTCAGAGG - Intronic
1102455760 12:113069966-113069988 GGGAGGAAACTGAGGCACAGCGG - Intronic
1103054149 12:117805427-117805449 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1103938312 12:124488404-124488426 GAGGAGAAACTGAGGCTCAGAGG - Intronic
1105640563 13:22259676-22259698 GGGAATAAACAGGGGCCCAGGGG - Intergenic
1106199738 13:27526436-27526458 AGGAAGACACTGAGGTTCAGAGG + Intergenic
1106794947 13:33195826-33195848 ATGAAAAAACTGAGGCTCAGAGG - Intronic
1107992147 13:45828082-45828104 GTGAGAAAACTGAGGTTCAGAGG - Intronic
1108078798 13:46710950-46710972 GTGAAGAAATTGAGGGACAGTGG - Intronic
1108462278 13:50678540-50678562 ATGAAAAAACTGAGGTTCAGGGG + Intronic
1110855680 13:80294308-80294330 AGGAACAGACTGAGAGTCAGTGG - Intergenic
1111901703 13:94207413-94207435 AGGAAGAAACTGAGGTTCATAGG + Intronic
1111955315 13:94750644-94750666 GGGAAAAAAATGAGGGAGAGTGG - Intergenic
1116007965 14:39316940-39316962 GGGAATATGCTGAGGTCCAGAGG + Intronic
1117653311 14:57928491-57928513 GGGCATTAACTGAGGCTGAGAGG + Intronic
1118329887 14:64807101-64807123 GGGAAAAAACTGTGGGACTGTGG - Intronic
1121333976 14:93065528-93065550 AAGAATAAACTGAGGCTTAGAGG + Intronic
1121430300 14:93881763-93881785 GGGACTACACTGAGAGCCAGGGG - Intergenic
1121661189 14:95636350-95636372 ATGAAGAAACTGAGGGTCAGAGG - Intergenic
1122114427 14:99520628-99520650 GGTGATAAACTGAGGTTCAGGGG - Intronic
1122211168 14:100175087-100175109 GGGAAGAGACTGAGGCACAGAGG - Intergenic
1122254913 14:100469443-100469465 GAGAGGAAACTGAGGCTCAGAGG + Intronic
1122698854 14:103573393-103573415 GCGAATCACCTGAAGGTCAGGGG - Intronic
1126427260 15:48542114-48542136 GGGCATGAGCTGAGGATCAGAGG - Intronic
1127272890 15:57417030-57417052 GTGAAGCAACTGAGGCTCAGTGG - Intronic
1127412021 15:58718853-58718875 GAGATGAAGCTGAGGGTCAGGGG - Intronic
1127791808 15:62405072-62405094 GGGAAAGAACTGAGGCTCAGAGG + Intronic
1128327075 15:66730788-66730810 ATGAAAAAACTGAGGCTCAGAGG + Intronic
1128357738 15:66939959-66939981 AGGAGGAAACTGAGGCTCAGAGG - Intergenic
1128360843 15:66960684-66960706 AGGAGGAAACTGAGGCTCAGAGG + Intergenic
1128683948 15:69670184-69670206 GTGAGGAAACTGAGGTTCAGAGG + Intergenic
1128730540 15:70017814-70017836 GGAAATAAATTGGGGGTCACTGG + Intergenic
1128732079 15:70028078-70028100 AGGAAGAAACTGAGGCACAGAGG + Intergenic
1128792647 15:70444449-70444471 AGGAAGAGACTGAGGCTCAGAGG - Intergenic
1129029181 15:72606090-72606112 AGGAGAAAACTGAGGCTCAGGGG - Intergenic
1129923139 15:79337784-79337806 ACGAGGAAACTGAGGGTCAGAGG - Intronic
1129940581 15:79493670-79493692 ATGAGTAAACTGAGGTTCAGTGG - Intergenic
1130274129 15:82467739-82467761 AGGAGGAAACTGAGGCTCAGAGG - Intergenic
1130466475 15:84195113-84195135 AGGAGGAAACTGAGGCTCAGAGG - Intergenic
1130497789 15:84478423-84478445 AGGAGGAAACTGAGGCTCAGAGG + Intergenic
1130588771 15:85199706-85199728 AGGAGGAAACTGAGGCTCAGAGG - Intergenic
1130955678 15:88625857-88625879 GGTAAGAAACTGAGGCACAGAGG - Intronic
1131217235 15:90548331-90548353 GGGAACAATCTGATGGTCAAGGG + Intronic
1131650974 15:94399427-94399449 GGGAATAAACTGAGGGTCAGAGG - Intronic
1131936934 15:97516864-97516886 AGGAGTAAACTGAAGCTCAGAGG + Intergenic
1132259384 15:100408906-100408928 GAGAGGAAACTGAGGCTCAGGGG + Intronic
1132302982 15:100787913-100787935 AGGAATCAACTGAGGCTCACTGG - Intergenic
1132397271 15:101483048-101483070 GGGTGTGAACTGAGGGACAGAGG - Intronic
1132446852 15:101931022-101931044 GAGAATAAAAGAAGGGTCAGGGG + Intergenic
1133470926 16:6074658-6074680 GGAAGTCAAGTGAGGGTCAGTGG + Intronic
1133996419 16:10751948-10751970 AGGAGGAAACTGAGGTTCAGAGG - Intronic
1135044009 16:19139907-19139929 GTGAATAAACTGAGGTTCAGAGG - Intronic
1135078816 16:19416590-19416612 GGGAGGAAATTGAGGCTCAGAGG + Intronic
1135537138 16:23302896-23302918 AGGTGCAAACTGAGGGTCAGAGG + Intronic
1136101502 16:28000024-28000046 TGGAAGAAACAGAGGTTCAGAGG + Intronic
1136169784 16:28482074-28482096 GGGAGTGAAGTGAGGGGCAGGGG + Intronic
1136230213 16:28881236-28881258 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1137229346 16:46548819-46548841 TGGAATAAACAGAAGGCCAGTGG - Intergenic
1137568141 16:49546944-49546966 GTGAGAAAACTGAGGCTCAGAGG - Intronic
1138477590 16:57281278-57281300 GTGAGAAAACTGAGGCTCAGAGG - Intronic
1138618280 16:58189841-58189863 AGGAATAAACTGAGGCTGAAGGG - Intronic
1138715872 16:59021537-59021559 AGGAGTCAACAGAGGGTCAGGGG - Intergenic
1138990807 16:62388721-62388743 ATGAAGAAACTGAGGTTCAGTGG - Intergenic
1139306300 16:65989111-65989133 GGAAATAAAATAAGCGTCAGTGG + Intergenic
1139352147 16:66343495-66343517 GAGAAAAGACTCAGGGTCAGGGG - Intergenic
1139441789 16:66971742-66971764 AGGAGGAAACTGAGGCTCAGAGG - Intronic
1139949398 16:70661813-70661835 GGGAATAGAGTGAGGGGCAGTGG - Exonic
1140733350 16:77876097-77876119 AGGAATGAACTTGGGGTCAGTGG - Intronic
1141987562 16:87589776-87589798 GGGAAGAAACTGAGGCTCTGGGG + Intergenic
1142530559 17:576834-576856 GGGAATGCACTGAGGTTCTGAGG - Intronic
1142531621 17:583275-583297 GGGAACACACTGAGGTTCTGAGG - Intronic
1143521472 17:7446706-7446728 AGGCATAAACTGTGGGTCAAGGG - Intronic
1144699267 17:17326235-17326257 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1144846278 17:18221313-18221335 AACAAGAAACTGAGGGTCAGGGG - Intergenic
1144966512 17:19079959-19079981 AGGAGGAAACTGAGGCTCAGAGG - Intergenic
1144981406 17:19172098-19172120 AGGAGGAAACTGAGGCTCAGAGG + Intergenic
1144986818 17:19206141-19206163 AGGAGGAAACTGAGGCTCAGAGG - Intergenic
1146318849 17:31830790-31830812 GGTAAGAAACTGAGGCCCAGGGG + Intergenic
1148463894 17:47853071-47853093 AGGAAGAAACTGAGGCTTAGAGG - Intronic
1151249230 17:72820788-72820810 GGGCAGAAACTGGGGGACAGAGG + Intronic
1151253998 17:72860881-72860903 GTGCATAAACTGAGGCGCAGAGG - Intronic
1151723321 17:75870570-75870592 AGGAAGAAACTGAGGCACAGGGG - Intergenic
1155201613 18:23522734-23522756 AGGAATCCACTGAGGGTCTGGGG + Intronic
1157310057 18:46546075-46546097 GGGGATACTTTGAGGGTCAGAGG + Intronic
1158121548 18:54054058-54054080 AGGAGGAAACTGAGGCTCAGAGG + Intergenic
1158446636 18:57527846-57527868 GAGAATAAAATGAAGGTCACAGG - Intergenic
1158882789 18:61797169-61797191 ATGAAGAAACTGAGGTTCAGAGG + Intergenic
1158883659 18:61805268-61805290 GGTAATAAACTGGGGGTTGGGGG - Intergenic
1160378414 18:78430857-78430879 GGGAATAAAGTGAGAGGCGGAGG - Intergenic
1160638367 19:101195-101217 GAGAATAAAAGAAGGGTCAGGGG - Intergenic
1161048691 19:2150906-2150928 GAGAGTAAACTGAGGGTCCAGGG + Intronic
1161514816 19:4690432-4690454 GTGAAGAAACTGAGGATAAGTGG + Intronic
1161760125 19:6164968-6164990 GTGAAGAAGCTGAGGCTCAGGGG - Intronic
1162768439 19:12934328-12934350 GTGAGAAAACTGAGGCTCAGAGG + Intergenic
1163328455 19:16620332-16620354 GTGAGGAAACTGAGGCTCAGCGG - Intronic
1164721787 19:30437899-30437921 GGCAATGAACTGAAGGCCAGGGG + Intronic
1164792675 19:31001588-31001610 AGGGATAAACTGAGGCTCAGAGG - Intergenic
1165485308 19:36091958-36091980 GGGAGCAAACTGAGGCTCAGGGG - Intronic
1165708529 19:37993178-37993200 ATGAAGAAACTGAGGGGCAGGGG - Intronic
1165807001 19:38586511-38586533 AGGAAAAACCTGAGGGTGAGAGG - Exonic
1166083535 19:40459947-40459969 TGGAAGAAACTGAGGTTCTGAGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166978842 19:46621096-46621118 GGGAAGAGAGTGAGGGACAGAGG - Exonic
927037624 2:19195931-19195953 AGGAATAAACTAGGAGTCAGAGG - Intergenic
929620888 2:43352913-43352935 GAGAATAAACTCATGGTTAGTGG - Intronic
929766783 2:44850310-44850332 TGGAAGAAACTGAGGCTAAGAGG - Intergenic
931009313 2:57890188-57890210 TGGATTAGACTTAGGGTCAGAGG + Intergenic
932121151 2:69101758-69101780 AGAAATAGACTGAAGGTCAGAGG - Intronic
932568158 2:72922398-72922420 TGGAATAGACAGATGGTCAGGGG - Intronic
936991766 2:118374228-118374250 ATGAAAAAACTGAGGTTCAGAGG - Intergenic
937441514 2:121919746-121919768 GGGCATCAACTGTGGGTCAGAGG + Intergenic
937777762 2:125800517-125800539 TGGAATAACATGAGGGTTAGAGG - Intergenic
938259143 2:129882812-129882834 GGGACCAAACTGCGGGTCTGAGG - Intergenic
938584705 2:132678883-132678905 GTAAAGAAACTAAGGGTCAGAGG - Intronic
938979890 2:136516337-136516359 AGGCAGAAACTGAGGCTCAGAGG - Intergenic
939214207 2:139215068-139215090 GAGAATATGCAGAGGGTCAGTGG - Intergenic
940457336 2:153917032-153917054 CTGAATAAACTGAGGCCCAGAGG - Intronic
941849782 2:170168184-170168206 GTGACAAAACTGAGGCTCAGGGG + Intergenic
942151381 2:173078941-173078963 GTGAGAAAACTGAGGATCAGGGG - Intronic
942537442 2:176979754-176979776 GTGAATAGACTAAGGCTCAGAGG - Intergenic
944691340 2:202161103-202161125 TTGAAGAAACTGAGGCTCAGGGG + Intronic
1168835646 20:875565-875587 ATGAAGAAACTGAGGCTCAGTGG - Intronic
1169013624 20:2273209-2273231 GTGAAGAAACTGAGTCTCAGAGG - Intergenic
1169648696 20:7842909-7842931 GGTAATAAACTGGGGGAAAGAGG - Intergenic
1171988774 20:31679365-31679387 GGTAAGAAACTGAGGCCCAGAGG + Intronic
1172008938 20:31835310-31835332 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1172232559 20:33346882-33346904 TGGAGGAAAGTGAGGGTCAGTGG + Intergenic
1172870361 20:38131917-38131939 ATGAATAAACTGAGGCACAGAGG + Intronic
1173813156 20:45968508-45968530 GGGAGTCAACTGAGGCTCAGGGG - Intronic
1173907659 20:46640630-46640652 ATGAATAAATTGAGGCTCAGGGG + Intronic
1173930678 20:46815493-46815515 GGGAAGGAACTGAAGATCAGAGG - Intergenic
1173943663 20:46933125-46933147 GGGCAAAAACTGAGGTTCACAGG - Intronic
1174040317 20:47694629-47694651 AGGAATCACCTGAGGCTCAGAGG - Intronic
1174171718 20:48621746-48621768 ATGAAAAAACTGAGGCTCAGAGG + Intergenic
1174176927 20:48651188-48651210 GGGAGTAAACTGAGGCTAAAGGG + Intronic
1174347020 20:49937506-49937528 GTGAATACACTGAGGGTCCGAGG + Intronic
1175067405 20:56301157-56301179 GGGAGTAAAAGGAGGGACAGAGG + Intergenic
1175653339 20:60748106-60748128 GGGCTAAAACTGAGTGTCAGTGG - Intergenic
1177161674 21:17554499-17554521 GGGGATAAACTGGGGATGAGAGG + Intronic
1177746174 21:25215778-25215800 GGGAATAAATGGAAGGTAAGAGG + Intergenic
1180669015 22:17538343-17538365 GGAAATACAATGAGGGACAGTGG - Intronic
1181469446 22:23128695-23128717 GGGAAGAAACTGAGGCACGGTGG + Intronic
1181785724 22:25225257-25225279 AGGAGGAAACTGAGGCTCAGAGG - Intronic
1181814844 22:25430111-25430133 GTGAAGAAAATGAGGGGCAGGGG + Intergenic
1181821217 22:25477140-25477162 GGTAAGAGACTGAGGGTGAGTGG + Intergenic
1181860536 22:25814530-25814552 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1181963368 22:26639011-26639033 GCGAGGAAACTGAGGCTCAGTGG - Intergenic
1182463988 22:30503161-30503183 ATGAAGAAACTGAGGCTCAGTGG + Intronic
1182564525 22:31187367-31187389 GGGAATACACTCAGGCTCAAGGG + Intronic
1183086435 22:35490028-35490050 AGGAGGAAACTGAGGCTCAGAGG - Intergenic
1183430655 22:37763543-37763565 GGGAAGAAACTAAGGCACAGAGG - Intronic
1184486155 22:44780912-44780934 AAAAATAAACTGAGGCTCAGAGG + Intronic
1184689532 22:46111143-46111165 GTGGAGAAACTGAGGCTCAGGGG - Intronic
949982710 3:9512260-9512282 GGGAAGAAACTGAGGCCCAGAGG - Intronic
950098716 3:10344703-10344725 AGGCAGAAACTGAGGCTCAGAGG - Intronic
950207003 3:11088566-11088588 AGGAAGAAACTGAGGCTCAGTGG + Intergenic
950454055 3:13082321-13082343 GGGGATAAAAAGAGAGTCAGGGG - Intergenic
951231800 3:20187658-20187680 GGCAGTAAACTGAGGGTTAATGG - Intergenic
952138479 3:30451648-30451670 AGGAATAAACTTAGAGTCAATGG - Intergenic
952654471 3:35768248-35768270 GGGAATGAGGTGAGGGTCTGGGG - Intronic
953275209 3:41489045-41489067 GTGGATAAACTGAGGGTCAGGGG - Intronic
953628372 3:44589706-44589728 GGATATAAACTGATGGTCAAAGG - Intronic
954148339 3:48645361-48645383 GGGCCAAAACTCAGGGTCAGAGG - Intronic
954416986 3:50398083-50398105 GGCAAGAAACTGAGGCCCAGAGG + Intronic
954751464 3:52816578-52816600 GTGAAGAAACTGAGGCTCAGAGG + Intronic
955348595 3:58178475-58178497 GGGAAGAAACTCAGGTTAAGTGG - Intergenic
956248732 3:67213448-67213470 TGCAATAAACAGAGAGTCAGAGG - Intergenic
956362574 3:68464741-68464763 GAGAATAAACTGAAGGTAGGAGG + Intronic
957477825 3:80749901-80749923 AGGAATAAATTCAGAGTCAGAGG + Intergenic
957765387 3:84617942-84617964 GGTCAGGAACTGAGGGTCAGGGG + Intergenic
957956766 3:87197308-87197330 GGGAATAGACTGAATGGCAGAGG + Intergenic
959973661 3:112434459-112434481 TTGAGTAAACTGAGGCTCAGAGG - Intergenic
960148443 3:114227814-114227836 ATGAAGAAACTGAGGGTAAGAGG + Intergenic
960632345 3:119744670-119744692 AGGAATAAGCTTAGGGGCAGGGG + Intronic
962041350 3:131710715-131710737 GGGAAGAAACTGATTTTCAGGGG - Intronic
962851503 3:139311551-139311573 GGGAAATAAATGAAGGTCAGAGG - Intronic
964203403 3:154143785-154143807 GGGAATAAATTCAGGGTAAAGGG - Intronic
966010849 3:175074773-175074795 GGGAGTAGACTGATGATCAGTGG + Intronic
966933658 3:184691702-184691724 AGGAATAAACTGAGGAGGAGAGG - Intergenic
967529305 3:190530904-190530926 GTGAAAAAACTGAAGCTCAGAGG + Intronic
968268652 3:197382477-197382499 TGGTACAAACTGGGGGTCAGAGG - Intergenic
969046419 4:4339963-4339985 AGGAGAAAACTGAGGCTCAGAGG - Intergenic
969063440 4:4458194-4458216 GTGAAGAAACTAAGGTTCAGAGG + Intronic
969067235 4:4496148-4496170 ATGAAGAAACTGAGTGTCAGAGG + Intronic
969254827 4:5994588-5994610 GTGAGGAAACTGAGGCTCAGAGG + Intergenic
969471440 4:7391638-7391660 TGGAATAAAGCGAGAGTCAGTGG + Intronic
970046953 4:11865264-11865286 GTGTAGAAACTGAGGCTCAGGGG + Intergenic
970161735 4:13195954-13195976 AGGAATATACTGAAGGGCAGTGG - Intergenic
970262811 4:14246596-14246618 AAGAATAAACTGTGGGACAGGGG + Intergenic
971579386 4:28315346-28315368 AGGAATAAACTAAGGCCCAGGGG - Intergenic
972108304 4:35522308-35522330 GGGAAGAAACTGAGAGACATCGG - Intergenic
972347072 4:38201308-38201330 GGGAAGAAACTGGGGGTTGGGGG + Intergenic
975645529 4:76542262-76542284 GAAAATAAACTGAGGCTTAGAGG + Intronic
976018015 4:80583515-80583537 GGGACAAAACTTAGGGTCAGTGG - Intronic
976208940 4:82648173-82648195 GGGAATGTCCTGAGGTTCAGTGG - Intronic
976221266 4:82758647-82758669 GGAAATAAGCTTTGGGTCAGCGG + Intronic
978627623 4:110704940-110704962 GGCAAGAAAGTGAGTGTCAGAGG - Intergenic
978744494 4:112176419-112176441 GTGAAGAAACTGAGAGTCAGTGG + Intronic
980233389 4:130072697-130072719 GGAAATAAAATGAGGGTCTAGGG - Intergenic
981916604 4:150040681-150040703 GGGAATAAAATGAGAATCACTGG + Intergenic
982069942 4:151686251-151686273 GTGAGGAAACTGAGGGTCAGAGG + Intronic
982106869 4:152018777-152018799 GGGAATGAACTGAGGGGCAGTGG - Intergenic
986760887 5:10878696-10878718 AGGAGCAAAGTGAGGGTCAGTGG - Intergenic
989138939 5:38182953-38182975 AGAAAGAAACTGAGGCTCAGAGG + Intergenic
990373741 5:55148873-55148895 GTGAAGAAACTGAGGCTTAGAGG + Intronic
990757093 5:59085621-59085643 GGGCATAAACTGAGTGTCCCAGG + Intronic
990855320 5:60260231-60260253 AGTGATAAACTGAGGCTCAGAGG + Intronic
990914936 5:60893455-60893477 GTGAACAAACTGAGGAGCAGAGG + Intronic
990987663 5:61655708-61655730 GGGAGGAAACTGAGGGACTGGGG + Intronic
992207996 5:74449582-74449604 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
995482624 5:112608210-112608232 GGGAATTCCCTGAGGGTCAAAGG + Intergenic
995575359 5:113525508-113525530 GTGAAGAAACTGAGGCTTAGAGG + Intronic
995730427 5:115234387-115234409 GGGAATACAGGGAGGGTGAGGGG + Intronic
995922632 5:117331961-117331983 CGGAATTAACTGAGGGACAGGGG + Intergenic
996941772 5:129015462-129015484 ATGAATAAACTGAGAATCAGAGG + Intronic
997206573 5:132053738-132053760 GGGAAGAACCTGGGGGGCAGAGG + Intergenic
997582170 5:135024952-135024974 GGGAAGAAACTGAAGCTCAAAGG - Intergenic
997678193 5:135730874-135730896 AGGAGGAAACTGAGGTTCAGAGG + Intergenic
997692916 5:135839106-135839128 GGGAAGAAACTGAGGGAGAAAGG - Intronic
997721508 5:136081436-136081458 ATGAATAAACTGAGAATCAGTGG + Intergenic
998134520 5:139667715-139667737 GGCATCAGACTGAGGGTCAGAGG + Intronic
998372601 5:141671256-141671278 GGGAATGACCTGAGGGCAAGAGG + Exonic
998416231 5:141948192-141948214 AGGAAAAATGTGAGGGTCAGGGG - Intronic
998617818 5:143760278-143760300 ATGAGAAAACTGAGGGTCAGAGG + Intergenic
998804266 5:145903406-145903428 GGGAAGCAACTGAGTTTCAGAGG - Intergenic
999165624 5:149546879-149546901 GGGAACAAACTGAGGGGGATGGG + Intronic
1001252790 5:170160625-170160647 TGAAAAAAACTGAGGCTCAGAGG + Intergenic
1001301562 5:170537432-170537454 GTGGAGAAACTGAGGCTCAGTGG - Intronic
1001542522 5:172549629-172549651 AGGAGGAAACTGAGGCTCAGGGG - Intergenic
1002192135 5:177483810-177483832 GGGAATGAACAGAGGGCCGGTGG + Intronic
1002845552 6:941464-941486 ATGAAGAAACTGAGGGTCACAGG - Intergenic
1004180931 6:13379868-13379890 GGAAGTGAAATGAGGGTCAGGGG + Intronic
1005041491 6:21604395-21604417 GGGCAGAGACTGAAGGTCAGGGG - Intergenic
1005145841 6:22689233-22689255 GTGAAGAAACTGAAAGTCAGAGG - Intergenic
1005954166 6:30651901-30651923 AGGAAGAAACTGAAGCTCAGAGG - Intronic
1006615958 6:35327079-35327101 GTGAGGAAACTGAGGCTCAGAGG - Intergenic
1006901636 6:37506360-37506382 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1007254341 6:40518119-40518141 GTGAAGAAACTGAGGCCCAGAGG - Intronic
1007274616 6:40664096-40664118 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1008035716 6:46742932-46742954 AGAAAGAAACTGAGGCTCAGAGG - Intergenic
1008286297 6:49655285-49655307 GGGGTTAAACTGAGTGACAGAGG - Intergenic
1011632807 6:89343895-89343917 GGGAATAAATAGAGGGGGAGAGG + Intronic
1012759474 6:103280064-103280086 ATGGATAAACTGAGGCTCAGAGG + Intergenic
1012853755 6:104476753-104476775 GGAAATAAACTGATGGTCTGTGG - Intergenic
1013985730 6:116190993-116191015 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1016384287 6:143515617-143515639 GTGAAGAAACTGAGGCACAGAGG - Intergenic
1016539551 6:145149071-145149093 GAAAATAAACTGAGTGTCAATGG + Intergenic
1017316224 6:153034573-153034595 AGGAAGAAACCGAGGCTCAGAGG + Intronic
1017415819 6:154219497-154219519 TGGGATGAACTGAGGCTCAGCGG + Intronic
1017607466 6:156149193-156149215 GTGAGAAAACTGAGGGTAAGTGG - Intergenic
1019499708 7:1358807-1358829 GGGAGGAAACTGAGGCACAGGGG - Intergenic
1019696393 7:2448582-2448604 GGGAAGAAGCTGAGGGTGGGTGG - Intergenic
1019854149 7:3587210-3587232 GAGGAGAAATTGAGGGTCAGAGG + Intronic
1020175190 7:5876592-5876614 GGGAATAAAATGTGGATGAGAGG + Intergenic
1020347637 7:7182674-7182696 GGGAATAATCTGGGCGGCAGCGG + Exonic
1020814083 7:12882858-12882880 TTGAAGAAACTGGGGGTCAGAGG + Intergenic
1020846569 7:13292234-13292256 GGAAGGAAACTGAGGTTCAGAGG + Intergenic
1021385956 7:20030634-20030656 GGGAATAAATTAAAGCTCAGAGG - Intergenic
1021440001 7:20667106-20667128 GGGAAAAAACTGTGCCTCAGAGG - Intronic
1021576143 7:22107958-22107980 TGAAATAAACTGAGGGGCAGAGG + Intergenic
1021980403 7:26048620-26048642 GAGAAGAAACTGAGGCTCAAAGG + Intergenic
1022318855 7:29269176-29269198 GGGAATAAAGAGAGGTTCACGGG - Intronic
1022627510 7:32053160-32053182 GCAAAGAAACTGAGGTTCAGGGG - Intronic
1023618572 7:42046722-42046744 GAGAATAGACTGAGGGAGAGAGG - Intronic
1023995036 7:45154614-45154636 GGAAAACAGCTGAGGGTCAGAGG + Intergenic
1025963413 7:66245325-66245347 GAGAGTAAGGTGAGGGTCAGTGG + Intronic
1026806668 7:73433594-73433616 GGGAAGAAACCGAGTGTAAGCGG + Intergenic
1028479562 7:91289952-91289974 GGGAAGAAACTGAGGCTTACAGG + Intergenic
1030096302 7:105903242-105903264 AGGAAGAAACTGAGGCTCAGGGG - Intronic
1031476147 7:122224224-122224246 AGGAGGAAACTGAGGTTCAGAGG + Intergenic
1031531456 7:122881812-122881834 GGGAATAAGGTGAGTTTCAGAGG + Intronic
1031553603 7:123144461-123144483 AGGAATAAACTGAGTCTTAGGGG + Intronic
1032898836 7:136283184-136283206 TGGAAGACAGTGAGGGTCAGAGG - Intergenic
1033329699 7:140407833-140407855 GGCAAAAAAGTGAAGGTCAGAGG + Exonic
1033541499 7:142360084-142360106 GGGAAACAACTGAGGATCAGTGG - Intergenic
1033774158 7:144588175-144588197 GGGAAGTAACTGAGGTACAGAGG + Intronic
1034418111 7:150975752-150975774 AAGAATAAGCTGAGGGTCACAGG + Intronic
1035051199 7:155999831-155999853 GGGAAGAATCAGAGGGACAGGGG + Intergenic
1035844109 8:2844781-2844803 GTGAAGAAACTTAGGGTTAGAGG - Intergenic
1035943040 8:3925764-3925786 GGGAATAAAAAGAGGTTCAATGG - Intronic
1036705529 8:11043509-11043531 GGGCAGAGACTGAGGCTCAGGGG - Intronic
1039311454 8:36321924-36321946 CGGAAGAAACTGAGGGTCAGAGG + Intergenic
1041747981 8:61230133-61230155 AGGAATAAACTAAGGTTGAGGGG + Intronic
1043153440 8:76747427-76747449 GGGAATTAACTGAGGGTGGAGGG - Intronic
1043309625 8:78842358-78842380 GGGAATAACCAGAGGGTTAAAGG + Intergenic
1043942920 8:86216015-86216037 CGGAAGAAACTGAGGTTCAGAGG + Intronic
1044751432 8:95420041-95420063 AGGAATAAACTGAGGCACATAGG + Intergenic
1045040115 8:98215597-98215619 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1045418830 8:101993847-101993869 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1046575420 8:116022317-116022339 GGGAAGGAAATGAGGGTGAGAGG - Intergenic
1047538645 8:125743045-125743067 GGGAAAAAAATGAGGGAGAGAGG - Intergenic
1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG + Intergenic
1047898420 8:129393000-129393022 AGGAAGAAAATGAGGATCAGAGG - Intergenic
1047904696 8:129460387-129460409 GGGGATAAGCTGTGGGGCAGGGG - Intergenic
1048363967 8:133722164-133722186 GGGAGGAAACTGAGGCCCAGAGG - Intergenic
1049204090 8:141355327-141355349 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1049420087 8:142512640-142512662 GTGAGGAAACTGAGGCTCAGAGG - Intronic
1050895717 9:10884446-10884468 GAGAGAAAACTGAGGGACAGAGG - Intergenic
1051182625 9:14427417-14427439 GAGGATAAACTGAGGTACAGAGG + Intergenic
1051454181 9:17234535-17234557 GGGAATAAACTGAAAATGAGAGG - Intronic
1052157437 9:25210594-25210616 AAAAATAAACTCAGGGTCAGAGG - Intergenic
1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG + Intronic
1054701819 9:68420416-68420438 GCGAATAAGCTCAAGGTCAGTGG - Intronic
1054873780 9:70074438-70074460 GGCAATACCCTGAGGGTAAGTGG + Intronic
1055440982 9:76335888-76335910 ATGAAGAAACTGAGGATCAGAGG + Intronic
1055651587 9:78411490-78411512 GGGACTGAACTGAGGGTGAAGGG + Intergenic
1055963598 9:81843930-81843952 GTGAAGAAACTGAGCCTCAGAGG + Intergenic
1056559959 9:87721602-87721624 GGAAATGCACTGAGGGACAGAGG - Intergenic
1056564794 9:87761721-87761743 GTGATGAAACTGAGGCTCAGAGG + Intergenic
1057123968 9:92601740-92601762 GGGGATACACTGAGGGTGAAGGG + Intronic
1057284841 9:93743644-93743666 GGTAATAAACTGAGGCTACGTGG + Intergenic
1059619252 9:115985245-115985267 AGGAGAAAACTGAGGGTAAGAGG - Intergenic
1059646851 9:116276478-116276500 AGGAAGAAACTGAGGCTCTGAGG - Intronic
1059699105 9:116758067-116758089 GGGAGGAAACTGAGGCACAGTGG - Intronic
1060031361 9:120217667-120217689 AGGAACAAACTGAAGGTCAAGGG + Intergenic
1060176166 9:121499168-121499190 GGGGATAAAGTGAGGGTCGCAGG - Intergenic
1060205708 9:121681604-121681626 GTGAGGAAACTGAGGTTCAGAGG + Intronic
1060274200 9:122169976-122169998 GGGGAGAAACTGAGGCGCAGTGG - Intronic
1060423754 9:123487871-123487893 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1060685399 9:125606478-125606500 GGGAGGAAACTGAGGGTAAATGG - Intronic
1060999928 9:127897280-127897302 GGGAAGAAACTGGGGCTTAGGGG + Intronic
1061008838 9:127943529-127943551 GTGAAGAAACTGAGGCTCAGAGG + Intronic
1061068980 9:128296951-128296973 TGGAGCAAACTGAGGCTCAGGGG + Intergenic
1062372784 9:136248767-136248789 AGGGAGAAACTGAGGCTCAGAGG + Intergenic
1189130801 X:38496097-38496119 GTGAAGAAACTGAGGAACAGAGG + Intronic
1190142241 X:47857943-47857965 GGGGAATAATTGAGGGTCAGGGG - Intronic
1190258572 X:48783450-48783472 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1191691742 X:63946389-63946411 AGGAGGAAACTGAGGGTGAGAGG + Intergenic
1192145718 X:68680950-68680972 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1192203200 X:69080219-69080241 GGGAAGAAACTGAGGTTCAGAGG - Intergenic
1192452042 X:71250783-71250805 GGGACTGAACTGTTGGTCAGGGG - Intronic
1193212835 X:78827861-78827883 GTGAAGAAACTGAGGCTCAATGG - Intergenic
1193537363 X:82730959-82730981 GGGAATAGAGTGAATGTCAGGGG - Intergenic
1195670975 X:107469695-107469717 AAGAATAAACTGAGGCACAGAGG - Intergenic
1195859018 X:109360763-109360785 AGGAAAAAACTAAGGCTCAGAGG - Intergenic
1198509243 X:137332711-137332733 CTGAAGAAACTGAGGCTCAGAGG - Intergenic
1200021184 X:153210880-153210902 GGGAATATTGTGAGTGTCAGAGG + Intergenic
1200374006 X:155760257-155760279 ATGAAGAAACTGAGGCTCAGAGG + Intergenic