ID: 1131652179

View in Genome Browser
Species Human (GRCh38)
Location 15:94412062-94412084
Sequence ATGGAGCCACAGAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 7, 3: 27, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131652174_1131652179 8 Left 1131652174 15:94412031-94412053 CCCAACAGCTGTTGTTTTTAATA 0: 1
1: 0
2: 5
3: 27
4: 387
Right 1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG 0: 1
1: 1
2: 7
3: 27
4: 318
1131652173_1131652179 27 Left 1131652173 15:94412012-94412034 CCATTGGTGTTAGGCAAGACCCA 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG 0: 1
1: 1
2: 7
3: 27
4: 318
1131652175_1131652179 7 Left 1131652175 15:94412032-94412054 CCAACAGCTGTTGTTTTTAATAT 0: 1
1: 0
2: 5
3: 70
4: 678
Right 1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG 0: 1
1: 1
2: 7
3: 27
4: 318
1131652172_1131652179 28 Left 1131652172 15:94412011-94412033 CCCATTGGTGTTAGGCAAGACCC 0: 1
1: 0
2: 0
3: 8
4: 48
Right 1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG 0: 1
1: 1
2: 7
3: 27
4: 318
1131652171_1131652179 29 Left 1131652171 15:94412010-94412032 CCCCATTGGTGTTAGGCAAGACC 0: 1
1: 0
2: 0
3: 9
4: 69
Right 1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG 0: 1
1: 1
2: 7
3: 27
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131652179 Original CRISPR ATGGAGCCACAGAATGAGGT AGG Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902992756 1:20200792-20200814 ATGGAATCACAGACTGAGGATGG + Intergenic
906734943 1:48116351-48116373 ATGGAGGCAAAGGGTGAGGTTGG - Intergenic
907394308 1:54178596-54178618 ATGGAGGGACAGGCTGAGGTGGG + Intronic
907438533 1:54464453-54464475 ATGGAGCCCTAGAATGAAGGGGG + Intergenic
907778083 1:57538406-57538428 ATGGAGCCAGGGAGGGAGGTAGG - Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908581711 1:65524259-65524281 ATGGAGACAAAAATTGAGGTAGG - Intronic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
910023461 1:82621486-82621508 TTGGGGCCACAGAGTGGGGTTGG + Intergenic
911407521 1:97461207-97461229 TTTGAGCTACAGAATGAAGTAGG - Intronic
912333310 1:108839498-108839520 GTTGAACCACAGAATGAGTTGGG - Intronic
914934464 1:151966214-151966236 ATGCTGCCACATAATGAGCTGGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
917309361 1:173662549-173662571 ATGGAGTGATAGAAAGAGGTTGG - Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918666438 1:187156487-187156509 CTGGACTCACAGAATGAGTTAGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919453772 1:197800460-197800482 AGGGAGGCACAGAAGGTGGTGGG + Intergenic
919572032 1:199260946-199260968 AAGGACACACAGAATGAGTTAGG - Intergenic
919934269 1:202241357-202241379 ATGGGGGCACAGTAAGAGGTAGG + Intronic
921997747 1:221440083-221440105 ACAGAGCCTCAGAATGAAGTGGG - Intergenic
922445600 1:225694487-225694509 AGGGAGCCAAAAAATGATGTAGG + Intergenic
923347768 1:233072884-233072906 CTGGCCCCACAGAATGAGTTAGG + Intronic
924888529 1:248247532-248247554 AGTGAGCCACAGGATTAGGTTGG - Intergenic
1064245457 10:13664353-13664375 ATGGAGTGTCAGAAAGAGGTTGG + Intronic
1066264002 10:33757572-33757594 ATGGATCCTAAGACTGAGGTGGG - Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066637284 10:37517296-37517318 ATGGAACAAAAGAATGAGGGAGG + Intergenic
1067466747 10:46505092-46505114 ATGGCCCCATAGAATGAGTTGGG - Intergenic
1067620440 10:47879513-47879535 ATGGCCCCATAGAATGAGTTGGG + Intergenic
1068878162 10:62019859-62019881 AGGGAGCCACAGAATTAGCAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1072434673 10:95404179-95404201 CTGGGGCCAGAGAATGAGGTGGG + Intronic
1072455141 10:95568775-95568797 ACTGAGCCACAGAAACAGGTAGG - Intergenic
1072545430 10:96433209-96433231 ATGGGGCCACAGAATCAAATGGG + Intronic
1072668435 10:97411506-97411528 ATTGAGCCACACACTGTGGTAGG - Intronic
1073027868 10:100501434-100501456 GTGAAGCCAGAGAATGATGTGGG - Intronic
1073697484 10:105886790-105886812 ATGGACCCACACAATCTGGTTGG - Intergenic
1074128564 10:110552431-110552453 ATGGAGGCAGAAAATCAGGTAGG - Intergenic
1074594066 10:114843881-114843903 ACGGATCCACTGACTGAGGTAGG - Exonic
1075885617 10:125896643-125896665 ATGGAGCCCCAGAGTAAGGGAGG + Exonic
1076883500 10:133251081-133251103 AAGGAGCCACAGAAGGCTGTGGG + Intergenic
1079102853 11:17552374-17552396 AAGAAGCCACAGAACCAGGTGGG - Intronic
1079728989 11:23916777-23916799 ATGGCCTCACAGAATGAGTTTGG + Intergenic
1080028390 11:27635635-27635657 ATGGACCCAAAGGGTGAGGTCGG + Intergenic
1080216939 11:29854448-29854470 CTGGCTCCACAGAATGAGTTAGG - Intergenic
1081612541 11:44571184-44571206 ATGGAGCTACAGCATGACCTTGG + Intronic
1081614067 11:44580003-44580025 AGGGAGCCACAGACAGAGATAGG + Intronic
1081642897 11:44769400-44769422 ATGGCCTCACAGAATGAGTTAGG + Intronic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084565480 11:69926167-69926189 ATGAAGACACAGAATGAACTGGG + Intergenic
1085495279 11:76963411-76963433 GTGGACCCAAAGAATGAGGTTGG - Intronic
1085594276 11:77793729-77793751 ATGGAGCCAGTGAGGGAGGTAGG - Intronic
1087722911 11:101687224-101687246 ATGGAGCCAGAGGAGGAAGTGGG - Intronic
1088582748 11:111331371-111331393 ATGGGGCCATAGAAAGAGGAGGG - Intergenic
1089168742 11:116498162-116498184 ATGGAGCCAGAAAGGGAGGTGGG + Intergenic
1092217527 12:6693706-6693728 GAGGAGGCACAGGATGAGGTGGG - Intergenic
1093616744 12:21234229-21234251 AGGGGGCCACAGGATGAGATAGG + Intronic
1096419251 12:51442229-51442251 ATGGAGCAAGATATTGAGGTTGG - Intronic
1096651810 12:53065584-53065606 ATGGACCCAAAGAATGGTGTTGG - Exonic
1096718224 12:53503583-53503605 ATTGAGCCAAAGAATCAGGGAGG - Intronic
1096800355 12:54106578-54106600 AAGGGGCCACAGGACGAGGTGGG + Intergenic
1098215559 12:68213381-68213403 CTGGACTCACAGAATGAGTTTGG + Intronic
1099955147 12:89346022-89346044 AGGGAGGCACAGAGAGAGGTGGG + Intergenic
1101119625 12:101565452-101565474 AGGGAGTTACAAAATGAGGTTGG - Intergenic
1101813016 12:108123796-108123818 ATGGAGCCACATAATAAGGGGGG - Intergenic
1102428717 12:112864847-112864869 GTGGAGCCAAAGAATTCGGTTGG + Intronic
1102542109 12:113628533-113628555 GAGTAGTCACAGAATGAGGTAGG + Intergenic
1102986060 12:117279669-117279691 ATGGAGCGAGAGGAAGAGGTTGG + Intronic
1103321620 12:120095661-120095683 TTGGAGCCACGGGATGGGGTGGG - Exonic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1107081238 13:36377059-36377081 CTTGAGTCACACAATGAGGTCGG - Intergenic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1111129790 13:83960679-83960701 ATGGATTCACAGAATGACTTTGG - Intergenic
1111336211 13:86827210-86827232 ATGTAGCTACAAAATAAGGTGGG + Intergenic
1114617486 14:24076017-24076039 AGGTAGCCACATAATGATGTGGG - Intronic
1115505685 14:34092336-34092358 ATGGAGCCAATGACTGAGGGTGG - Intronic
1115762737 14:36591445-36591467 ACGGAGGCACAGAGGGAGGTTGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1115963305 14:38860325-38860347 CTGGCTCCACAGAATGAGTTAGG + Intergenic
1117389341 14:55248086-55248108 AAGAAGCCACAGAATAAGGGAGG + Intergenic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122597598 14:102903969-102903991 AAGCAGGCAGAGAATGAGGTTGG + Intronic
1122797969 14:104215929-104215951 CTGGAGCCACATGAGGAGGTAGG - Intergenic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123124291 14:105934576-105934598 CTGGACTCACAGAATGAGTTGGG - Intergenic
1202872451 14_GL000225v1_random:177297-177319 ATGGAGCCCCAGAGTAAGGGAGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1124155887 15:27225023-27225045 TCAGAGCAACAGAATGAGGTGGG - Intronic
1125118439 15:36123071-36123093 ATGTAGACACAGAATCAGTTTGG - Intergenic
1125733156 15:41905525-41905547 ATGGAGCCACAGACTTACGTGGG + Intronic
1126179619 15:45772348-45772370 ATGGAGACACACACAGAGGTGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126923783 15:53558762-53558784 ATGGAGCCAATGACTGAGGCTGG + Intronic
1126938024 15:53733436-53733458 ATGTAGCCACAGGAAGAGCTGGG - Intronic
1128618971 15:69132768-69132790 AGGGAGCCAGAGCATGAGGAAGG + Intergenic
1130366693 15:83247094-83247116 CTGGTGTCACAGAATGAGTTAGG + Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131945302 15:97613591-97613613 CTGGAGACATAGAATGAGTTTGG - Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133059473 16:3165109-3165131 ATGGGGACACAGATTGAGTTGGG - Intergenic
1133407707 16:5538870-5538892 ACGGAGCCACTGGCTGAGGTGGG - Intergenic
1133970205 16:10562056-10562078 CTGGCCTCACAGAATGAGGTGGG - Intronic
1135834724 16:25814854-25814876 ATGGAGCCACAAATTCAGGAAGG + Intronic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1138554785 16:57764930-57764952 GAGGAGCCACAGCATGAGGGTGG + Intronic
1139306131 16:65987845-65987867 GTGGAGCCACACAAAGAGTTTGG - Intergenic
1140345110 16:74205945-74205967 AAGGAGCCAAAGAAAGAGCTGGG + Intergenic
1141072765 16:80973187-80973209 AGGGAGCCAGAGAATGGGGCCGG + Exonic
1141286379 16:82676329-82676351 ATGGTGCCACAGAATGAGGTAGG - Intronic
1142135383 16:88449624-88449646 AAGGAGCCACAGAATGTTCTAGG - Intergenic
1143602836 17:7960525-7960547 ATGCAACCACAGCATGATGTTGG - Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1146445331 17:32928220-32928242 CGGGAGCCACAGCCTGAGGTGGG + Exonic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146889632 17:36497952-36497974 ATGGAGCATCAGAATCAGCTGGG + Intronic
1146902547 17:36598085-36598107 ATGGAGCCACAGAATGCTAGGGG - Intronic
1146914165 17:36667476-36667498 AGCGAGCCAGAGAATGGGGTGGG - Intergenic
1147916205 17:43888422-43888444 ATGGAGCCCCAGAGTGAGGGAGG + Intronic
1148330851 17:46813126-46813148 ATGGAGCCACAGAAAGAAACGGG + Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1149052163 17:52318637-52318659 ATGAAGCCCCAGAATGATGTGGG + Intergenic
1150465926 17:65392586-65392608 ATGGATCCACACAATTAGGATGG - Intergenic
1151019339 17:70595997-70596019 TTAGAGTCTCAGAATGAGGTGGG + Intergenic
1151410575 17:73924816-73924838 ATGAAGACACAGCAAGAGGTCGG + Intergenic
1151457297 17:74233621-74233643 ATGCACCCACAGAGTGGGGTGGG + Intronic
1151534252 17:74729759-74729781 GTGGAGCCCCAGAAGGAGATGGG - Intronic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1156150191 18:34232824-34232846 ATGGCCTCACAGAATGAGCTAGG - Intergenic
1156340150 18:36203346-36203368 AGAGAGCAAGAGAATGAGGTGGG + Intronic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160085849 18:75777100-75777122 AGGGAGGCAGAGAATGAGGGAGG - Intergenic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1161872173 19:6878536-6878558 AAGGAGCCACAGGCTCAGGTTGG - Intergenic
1162257015 19:9498776-9498798 ATGGACCCACAGAGAAAGGTGGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166837902 19:45678310-45678332 GTGCAGCCACTGAATGGGGTGGG + Intronic
1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG + Intergenic
1167621963 19:50565753-50565775 AGGGAGCCACAGACTCAGGGAGG - Intronic
1167628615 19:50608712-50608734 ATGGAGCCACCGAAGCTGGTGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167762107 19:51456262-51456284 ATGGATCCAGAGAAAGAGGAAGG + Intronic
1167777095 19:51565382-51565404 ATGGAGCCCCTGACTTAGGTGGG + Intergenic
1168666681 19:58209843-58209865 ATGGAGCCACAGTACGATGCAGG + Intronic
925270400 2:2602066-2602088 AAGGAGCCACATAAATAGGTAGG + Intergenic
926383979 2:12317822-12317844 AGGGAGCCACGGACTTAGGTGGG + Intergenic
926811012 2:16755427-16755449 ATGGAGCTGCAGAGAGAGGTGGG + Intergenic
926866711 2:17367486-17367508 ATGGCATCACAGAATGAGTTAGG + Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
929571405 2:43025391-43025413 GTGGAGCCACAGAGTATGGTGGG + Intergenic
932259203 2:70312991-70313013 ATGGAGCCCCAGAGTGATGTGGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
936450072 2:112627257-112627279 ATGCAGCCACAGGCTGAGTTGGG + Intergenic
936644619 2:114354724-114354746 AGGGAGCTACAGAAAGAGGAGGG + Intergenic
938251489 2:129819225-129819247 AGTGAGCCACAGGATGAGGGAGG + Intergenic
939053403 2:137332986-137333008 AGTGAGCAACAGAATGAGTTAGG + Intronic
940206274 2:151205320-151205342 CTGGATCCCCAGAATCAGGTAGG + Intergenic
940634071 2:156276054-156276076 AGGGAGTCACAGAATGACCTTGG + Intergenic
941780202 2:169435771-169435793 ATGGCCTCACAGAATGAGTTTGG - Intergenic
942132914 2:172898463-172898485 GTGGGTCCACAGAGTGAGGTGGG - Intronic
942942296 2:181632740-181632762 GAGGAGCCACAGGATGAGGGAGG - Intronic
943797735 2:192018064-192018086 ATGGAGTCACAGCAAGAGATTGG + Intronic
946199937 2:218065519-218065541 GAGGAGCCACTGAATGAGGTGGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947321784 2:228927173-228927195 ATGGAGCCACAGAATGGAAGGGG - Intronic
949002605 2:241625127-241625149 CTGGACACACAGAATGAGTTAGG - Intronic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169825464 20:9763591-9763613 ATTAAGCAACAGAATGAAGTTGG + Intronic
1169892289 20:10466321-10466343 ACAGAGACACACAATGAGGTAGG - Intronic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171796096 20:29567764-29567786 AAGGGGCCACAGGATGAGGTGGG - Intergenic
1171852137 20:30316403-30316425 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1172371066 20:34392442-34392464 ATGTAAGCACAGAATGAAGTAGG + Intronic
1173933889 20:46844746-46844768 AAGGAGCCAGAGAAAGAGTTGGG - Intergenic
1175162604 20:57020267-57020289 ACGGAGCCACAGGATAAGGCAGG - Intergenic
1176857260 21:13982805-13982827 ATGGCCCCACAGAATAAGTTTGG + Intergenic
1176867348 21:14061425-14061447 ATGGCCCCACAGAATAAGTTTGG - Intergenic
1177081807 21:16648886-16648908 AGGGAGCTAGAGAAGGAGGTTGG + Intergenic
1177255835 21:18661947-18661969 CTGGAGACACGTAATGAGGTAGG - Intergenic
1178201501 21:30411895-30411917 CTGGAGTCATAGAATGAGTTAGG - Intronic
1178733583 21:35128998-35129020 ATGGAACCACAGAATGTTCTAGG - Intronic
1180285647 22:10742179-10742201 ATGGAGCCCCAGAGTAAGGGAGG + Intergenic
1180600084 22:17009773-17009795 AGGGAGACACTGGATGAGGTGGG + Intergenic
1181338244 22:22157552-22157574 AGGGAGCCAGAGAATCAAGTGGG - Intergenic
1181434056 22:22900170-22900192 ATCCAGACCCAGAATGAGGTAGG + Intergenic
1181434994 22:22905536-22905558 ATCCAGACCCAGAATGAGGTAGG + Intergenic
1181663780 22:24375310-24375332 ATGGCCTCACAGAATGAGTTAGG - Intronic
1182044564 22:27264188-27264210 GGGGAGCCACAGAAGGGGGTGGG + Intergenic
1183728068 22:39600436-39600458 TTGCAGCCACAGTGTGAGGTGGG - Intronic
950040735 3:9917616-9917638 ACGGAGCCCCAGAAAAAGGTAGG + Exonic
950413050 3:12851378-12851400 GTGGAGCCACAGAATGGGGGAGG + Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
951367445 3:21801327-21801349 CTGGACCCATAGAATGAGTTAGG + Intronic
952557719 3:34552053-34552075 ACGGAGACAGAGAAGGAGGTAGG - Intergenic
952560663 3:34589552-34589574 CTGGCCCCATAGAATGAGGTAGG + Intergenic
952741713 3:36740387-36740409 ATGGACCCACATGATGTGGTAGG + Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
953263530 3:41363456-41363478 TTGGAGCCACACAGAGAGGTAGG - Intronic
953367096 3:42354216-42354238 ATGGAGCCAGAGAGTGGGGATGG - Intergenic
953793747 3:45967445-45967467 AAGGAGCTACAGAATGTGGTCGG - Exonic
954205207 3:49053712-49053734 ATGGGGCCACAGATGGCGGTTGG + Intronic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
954782848 3:53073515-53073537 ATGGAGCCACGGGCTGAGGCTGG + Intronic
955043715 3:55340166-55340188 AAGGAGCCACACAGGGAGGTGGG + Intergenic
955435302 3:58893639-58893661 ATGGCCTCACAGAATGAGTTAGG + Intronic
957707664 3:83811145-83811167 ATTGATTCACAGAATGAGTTGGG + Intergenic
958579657 3:96001514-96001536 ATGGACACAAAGAGTGAGGTTGG - Intergenic
959921390 3:111872169-111872191 ATGTATCCACAGAATGGGCTGGG - Intronic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961716486 3:128861181-128861203 GTGGAGCCACAGAATGCGGGAGG - Intergenic
961805209 3:129484200-129484222 GTGGAGCCACAGAATGGGGGAGG + Intronic
962060329 3:131920085-131920107 ATGAATCCACAGAAGGATGTTGG - Intronic
962758848 3:138489710-138489732 CTGGCCTCACAGAATGAGGTTGG + Intergenic
963666335 3:148192455-148192477 AGGAAGCCACAGTATGAGCTGGG + Intergenic
965073630 3:163948388-163948410 TTGGAGCAACAAAATGAAGTAGG + Intergenic
966978089 3:185104179-185104201 ATGGACACAAAGGATGAGGTTGG - Intronic
967627848 3:191707185-191707207 CTGGACCTACAGAATGAGTTAGG - Intergenic
971076068 4:23151465-23151487 TTATAGGCACAGAATGAGGTGGG - Intergenic
972926347 4:44013827-44013849 ATGGGGCCACAAACTGAGGATGG + Intergenic
974304968 4:60124402-60124424 AAGGAGGTAGAGAATGAGGTAGG + Intergenic
974889672 4:67865981-67866003 CTGGAGTCATAGAATGAGTTCGG - Intronic
975879190 4:78882816-78882838 ATGAAGCCACAGAATGATAATGG + Intronic
978911925 4:114074011-114074033 CTGGTTTCACAGAATGAGGTTGG - Intergenic
980362869 4:131763293-131763315 ATGGAGCCACAGATCGACGCAGG + Intergenic
981005340 4:139869012-139869034 AGGGAGCCACAGAAATGGGTGGG + Intronic
982220209 4:153118123-153118145 ATCTAGTCACAGAATGAGATGGG + Intergenic
982391350 4:154867626-154867648 ATGGTGCCACAGTTTGAGTTTGG + Intergenic
983439050 4:167757505-167757527 TTGGCCCCACAGAATGAGTTGGG - Intergenic
983732240 4:171010436-171010458 AGAGAGCAAGAGAATGAGGTGGG - Intergenic
983977904 4:173958230-173958252 ATGAAGCCACATAATCAGGGAGG + Intergenic
984157018 4:176206141-176206163 AGGGAGCCACTGAATGGGATTGG - Intergenic
986102131 5:4622799-4622821 ATGATGCCACAGGAAGAGGTGGG + Intergenic
986280127 5:6315836-6315858 ACTGTGCCAGAGAATGAGGTGGG + Intergenic
989103852 5:37842577-37842599 ATGGTCCCTCAGAAGGAGGTGGG + Intergenic
989481604 5:41937011-41937033 ATTGACCCACAGAATGTAGTAGG + Intronic
991159268 5:63477761-63477783 CTGGAGGGACAGAATGAGTTTGG + Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
992726241 5:79610392-79610414 CTGGCCCCACAGAATGAGCTGGG + Intergenic
996195613 5:120603068-120603090 ATGGCTTCATAGAATGAGGTGGG + Intronic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1000284894 5:159818597-159818619 ATGGAGCCACAGGATGAAAGAGG + Intergenic
1000337242 5:160250945-160250967 ATGGAGGCTCAGAGAGAGGTTGG + Intergenic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1002061485 5:176628384-176628406 ATGAGGCCACAGGATGAGGGTGG - Intronic
1003790666 6:9543843-9543865 AGGGAGCCAGAGAGAGAGGTGGG + Intergenic
1003823726 6:9928882-9928904 CTGGACTCACAGAATGAGTTAGG - Intronic
1004989975 6:21125885-21125907 GGGGAGACACACAATGAGGTCGG - Intronic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006927476 6:37665157-37665179 ATGGGGCTAGACAATGAGGTAGG - Intronic
1006998489 6:38285392-38285414 ATGGTGCCACTGAATGAGATGGG + Intronic
1007196183 6:40062691-40062713 GTAGAGCCACTAAATGAGGTGGG - Intergenic
1007245917 6:40462499-40462521 AGGGAGCGAAAGAGTGAGGTAGG - Intronic
1007581969 6:42965205-42965227 AAGGAGGCACAAAATGAGGGTGG + Intronic
1008258357 6:49333037-49333059 ATGTACTCACAGAATGTGGTTGG - Intergenic
1008315437 6:50033817-50033839 CTGGCTTCACAGAATGAGGTAGG - Intergenic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1011730736 6:90260769-90260791 AGGAAGCCACAGAATGTGGGAGG + Intronic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1015060280 6:128956124-128956146 ATGGAGCCACAGGATGAAGATGG + Intronic
1015112468 6:129609085-129609107 ATGGAGGGAAAGAATGAGGGGGG + Intronic
1016565239 6:145444587-145444609 CTGGACCCATAGAATGAGTTGGG + Intergenic
1016572788 6:145533519-145533541 ATGGAGGCAGAGAAGTAGGTGGG - Intronic
1016707430 6:147127013-147127035 ATGGAGCAAAAGAATGACCTAGG + Intergenic
1017932175 6:158966335-158966357 CTGGTCTCACAGAATGAGGTGGG + Intergenic
1017995381 6:159527637-159527659 CTGGAGCCACAGCCTGGGGTAGG - Intergenic
1019367810 7:644338-644360 CTGGAGGTACACAATGAGGTGGG + Intronic
1021378299 7:19935594-19935616 ATGGAACCAGGGAATAAGGTAGG + Intergenic
1022323875 7:29312296-29312318 AGGGAGGGAGAGAATGAGGTAGG - Intronic
1022521065 7:31007153-31007175 ATGGAGCCACTGCATGAGCTTGG - Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1023234940 7:38075343-38075365 ATGGCCTCACAGAATGAGTTGGG + Intergenic
1024452760 7:49566703-49566725 CTGGATTCACAGAATGAGTTAGG - Intergenic
1024803457 7:53108179-53108201 AGGGAAGCAAAGAATGAGGTGGG + Intergenic
1026201424 7:68217949-68217971 ATAGAGCCACAGGGAGAGGTTGG - Intergenic
1027627151 7:80560446-80560468 CTGGCCTCACAGAATGAGGTAGG + Intronic
1028155424 7:87423822-87423844 ATGGAGCCAGTCAGTGAGGTTGG + Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028600907 7:92599474-92599496 ATGGACCCTGAGACTGAGGTGGG - Intergenic
1028971958 7:96869179-96869201 ATTAATACACAGAATGAGGTTGG + Intergenic
1031038963 7:116818587-116818609 ATGGTGTAACAGAATGAGATAGG + Intronic
1031787502 7:126052553-126052575 AAGGAGGCACAGAATGTGGTAGG + Intergenic
1032672154 7:134094550-134094572 CTGGATTCACAGAATGAGTTAGG - Intergenic
1033048315 7:137982022-137982044 ATGGGGCTGCACAATGAGGTGGG + Intronic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1036036783 8:5028701-5028723 ATGAAGCAACCAAATGAGGTGGG - Intergenic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1038770354 8:30473280-30473302 ATAGAGCCAAAAGATGAGGTGGG - Intronic
1040289101 8:46115320-46115342 ATGGTACCACAGAGTGGGGTGGG - Intergenic
1040305868 8:46211479-46211501 ATGGGGCCACAGGATGATGTCGG + Intergenic
1040307107 8:46217779-46217801 ACGGGGCCACAGAATGGCGTGGG - Intergenic
1040311074 8:46237164-46237186 ATGGAGCCACAGACTGTCATGGG + Intergenic
1040337044 8:46421306-46421328 ATGGGGCCGCAGAATGGCGTGGG + Intergenic
1040739134 8:50550232-50550254 AGGCAGGCTCAGAATGAGGTGGG - Intronic
1041828924 8:62130572-62130594 ATGGTACCACAGAAAGAGCTTGG - Intergenic
1043392450 8:79804762-79804784 ATGGAGCCACTGCATGAGTGGGG + Intergenic
1043457217 8:80424641-80424663 ATTGAGCAACAAGATGAGGTAGG - Intergenic
1048386041 8:133913395-133913417 ATGGAGCCACAGACTGAAGTTGG - Intergenic
1048488272 8:134868445-134868467 ATGGAGCTAAAGAATGAGTGTGG + Intergenic
1051385408 9:16502660-16502682 AGGAAGCCACAGAATCATGTAGG + Intronic
1051522458 9:18004450-18004472 GTGAAGGCACAGAATGATGTGGG + Intergenic
1051672699 9:19528098-19528120 ATGGAGCCAAAGAACGTGATGGG + Exonic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1053285451 9:36847181-36847203 ATGGGGCCACAGAACGACATGGG - Intronic
1053789918 9:41679661-41679683 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054155218 9:61635096-61635118 AAGGGGCCACAGGATGAGGTGGG - Intergenic
1054178257 9:61891350-61891372 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054475012 9:65566204-65566226 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054659272 9:67689474-67689496 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1055273179 9:74584809-74584831 CAGGAGCCACAGAATGAGTCTGG + Intronic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1056156994 9:83847683-83847705 ATGGCGCACCAGATTGAGGTTGG - Intronic
1056353547 9:85775838-85775860 ATGGTGCACCAGATTGAGGTTGG + Intergenic
1056948997 9:91026887-91026909 GAGGAGCCAAAGAAGGAGGTGGG - Intergenic
1057023840 9:91721285-91721307 AGGAAGCCACAGAATCAGGAAGG + Intronic
1057872570 9:98729316-98729338 AATGAGCCAGCGAATGAGGTGGG - Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1060282841 9:122225763-122225785 ATGGAGCCGGAGACAGAGGTTGG + Intronic
1062013412 9:134278926-134278948 AGGAAGCCACAGAGTGTGGTAGG - Intergenic
1203731999 Un_GL000216v2:99245-99267 ATGGAGCCCCAGAGTAAGGGAGG + Intergenic
1186168509 X:6852840-6852862 ATGGATACAAAGGATGAGGTTGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188650042 X:32621324-32621346 GTGGACCCACAGATTAAGGTAGG - Intronic
1191752279 X:64555880-64555902 ATGGAGCTAGAGGCTGAGGTGGG + Intergenic
1193180133 X:78445282-78445304 CTGGAGTCATAGAATGAGTTGGG + Intergenic
1193217085 X:78876015-78876037 ATGAATTGACAGAATGAGGTAGG + Intergenic
1193218563 X:78895315-78895337 CTGGCCCCATAGAATGAGGTAGG + Intergenic
1193479258 X:82007237-82007259 CTGGACTCACAGAATGAGTTGGG + Intergenic
1193852366 X:86554643-86554665 ATGATGCCATAGAATGAGATTGG + Intronic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194322868 X:92474082-92474104 ATTGAGCCACAGATAGAGATAGG - Intronic
1196619468 X:117806279-117806301 ATGCAGCCACAGATGGGGGTTGG - Intergenic
1196654370 X:118201651-118201673 ATGGGTCCAGAGAATGAGGCAGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197828203 X:130613264-130613286 CTGGTGCCACAGAATGAGCCAGG - Intergenic
1197919597 X:131578414-131578436 ATGGAGCTATATAATGGGGTAGG + Intergenic
1199194909 X:145016839-145016861 CTGGCCTCACAGAATGAGGTTGG - Intergenic
1200306694 X:155032615-155032637 ATTAATCCACAGAATAAGGTAGG - Intronic
1200631021 Y:5587561-5587583 ATTGAGCCACAGATAGAGATAGG - Intronic