ID: 1131652626

View in Genome Browser
Species Human (GRCh38)
Location 15:94417856-94417878
Sequence CGACTAAGGTACCCGAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 13}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131652626_1131652629 15 Left 1131652626 15:94417856-94417878 CCTGAATTCGGGTACCTTAGTCG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1131652629 15:94417894-94417916 AATATGTACAGAGCTATTGCAGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131652626 Original CRISPR CGACTAAGGTACCCGAATTC AGG (reversed) Intronic
1066178030 10:32930147-32930169 CATCTAATGTACCCCAATTCTGG + Intronic
1084981745 11:72832643-72832665 TGACCTAGGCACCCGAATTCAGG - Intronic
1087663576 11:101015912-101015934 CTACAAAAGTACCTGAATTCAGG - Intergenic
1128478937 15:68020738-68020760 CAACTGAGGTTCCCAAATTCGGG + Intergenic
1129010792 15:72415065-72415087 AGAGTCAGGTACCCAAATTCAGG + Intergenic
1131652626 15:94417856-94417878 CGACTAAGGTACCCGAATTCAGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
927549831 2:23988303-23988325 CGACTAATAGACCCTAATTCAGG + Intronic
938313931 2:130313795-130313817 TGACTAAGGTGCCAGATTTCAGG + Intergenic
968144828 3:196289229-196289251 AGACTAAGGTACCCCAAATAAGG + Intronic
976922968 4:90460462-90460484 CGACAAAGTTACCAGAATTTGGG + Intronic
986451401 5:7869229-7869251 CGGCTACGGTTCCCGGATTCCGG + Intronic
1001364529 5:171123211-171123233 CCACCAAGGTACCTGAATACAGG + Intronic
1032145529 7:129376188-129376210 CTACTAAGGTACCACAATTGGGG + Intronic