ID: 1131653389

View in Genome Browser
Species Human (GRCh38)
Location 15:94427476-94427498
Sequence GGGGCTGGAGGGAGACAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1262
Summary {0: 1, 1: 1, 2: 11, 3: 122, 4: 1127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131653384_1131653389 -6 Left 1131653384 15:94427459-94427481 CCATGTCTTACCATGGTGGGGCT 0: 1
1: 1
2: 1
3: 5
4: 100
Right 1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG 0: 1
1: 1
2: 11
3: 122
4: 1127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131653389 Original CRISPR GGGGCTGGAGGGAGACAGCA AGG Intronic
900003523 1:29228-29250 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
900023243 1:199744-199766 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
900034224 1:393526-393548 AGGGAAGGAGGGAAACAGCAGGG - Intergenic
900055059 1:623416-623438 AGGGAAGGAGGGAAACAGCAGGG - Intergenic
900163832 1:1236901-1236923 GGGGCTGGGAGGAGACCTCAAGG - Intergenic
900622915 1:3595628-3595650 GGGGCAGCATGGAGGCAGCAGGG + Intronic
900713426 1:4129198-4129220 AGAGCTCGAGGGAGACAGCTTGG - Intergenic
900887127 1:5423082-5423104 GTGGCAGGTGGGAGACAGCCTGG - Intergenic
900932910 1:5747876-5747898 GAGGCAGGAGGGAGAAAGGAAGG + Intergenic
900987149 1:6079703-6079725 GGGGCTGGAGGCAGGGAGCGGGG + Intronic
901130151 1:6957268-6957290 TGACCTGGAGGCAGACAGCAGGG - Intronic
901323237 1:8351871-8351893 GGGGCTGCAGGCAGCCTGCAGGG - Intergenic
901352323 1:8608437-8608459 GGGGCTGCAGTGAGCCAGAATGG + Intronic
901455434 1:9360405-9360427 GTGGCTGGAGGAAGACAGACAGG + Intronic
901799904 1:11701973-11701995 GGGGCTGGGGGAAGACTACACGG - Intronic
901843260 1:11966524-11966546 GGGGGTGGGGGGAGGCAGGATGG + Intronic
901934077 1:12616251-12616273 AGGGCTGGCTGGAGACAGCCTGG + Intronic
902331058 1:15731431-15731453 AGGGGAGGAGGGAGGCAGCAAGG + Intronic
902333621 1:15742807-15742829 GGGGCGGGAGGGAGGCAGCGAGG - Intronic
902574630 1:17369742-17369764 GGGTCTGGAGGAAGGCAGCCTGG - Intergenic
902731066 1:18369112-18369134 GGGGCATGGGGGACACAGCAGGG + Intronic
902756442 1:18552418-18552440 GGGGCAGGAGGAAGACATGATGG - Intergenic
903186685 1:21633255-21633277 GAGGCTGGAGGGAGTCAGCAGGG - Intronic
903279969 1:22244828-22244850 GGTGCTGGGGGGAGGCAGCCGGG + Intergenic
903331713 1:22600062-22600084 GGGGATGGAGGGAGGAAGGAAGG + Intronic
903360662 1:22775036-22775058 GGGGCAGGAGGAGGGCAGCAGGG - Intronic
903364473 1:22797527-22797549 GGGGCTGGGTGGAGTCATCAGGG - Intronic
903676522 1:25067978-25068000 GGGGCTGGAGAGTGAAAGGATGG - Intergenic
903724591 1:25431213-25431235 GGAGCTGGAGGGGGACCGCAGGG - Intronic
904122656 1:28211232-28211254 GGGGGAGGAGGGAGACTGAAAGG + Intronic
904330543 1:29755510-29755532 GGGTATGGAGGGAGACCCCAGGG + Intergenic
904337966 1:29810308-29810330 AGGGCAGGAGAGAGACAGCATGG - Intergenic
904416132 1:30362085-30362107 GGGTATGGAGGGAGACCCCAAGG - Intergenic
904788205 1:32998347-32998369 AGGGCAGGTGGGAGGCAGCAGGG - Intergenic
905318268 1:37097300-37097322 TGGGTTGGAAGGAGACAGAATGG + Intergenic
905933510 1:41806367-41806389 GGGGGTGAAGGGAGAGGGCAGGG - Intronic
906201638 1:43964168-43964190 GAGCCTGCAGGGAGACAGCGTGG - Intronic
906316679 1:44791007-44791029 GGGGGTGGAGGGAGGCAAGAAGG - Intergenic
906451245 1:45950067-45950089 GGGGGTGGAGAGAGAGAGGAGGG + Intronic
906482680 1:46209844-46209866 AGGGATGGAGGGAGGCAGAAAGG + Intronic
906610479 1:47198455-47198477 GAGGCTGGAGGGAGTCAGTGTGG + Intergenic
906895438 1:49765115-49765137 GGGGGTGGAGGGACACAGCTGGG - Intronic
907278530 1:53329865-53329887 GAGGCTGGAGGGAGTTGGCAAGG + Intergenic
907290725 1:53411010-53411032 GTGGCTGGTGGGGGAGAGCAGGG + Intergenic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907326922 1:53644263-53644285 GAGGCTGGAGGTGGACAGGATGG - Intronic
907724261 1:57004207-57004229 GGGGCTGGGAGAAGAAAGCAAGG - Intronic
907732379 1:57079650-57079672 GGGCCTGTAGTGAGTCAGCATGG - Intronic
907840816 1:58155519-58155541 GGTGCTAGAGGGAGACTCCAAGG - Intronic
908473985 1:64470726-64470748 GGGAGTGGGGGGAGGCAGCATGG + Intergenic
908597939 1:65708602-65708624 GGGGCTGGGGATAGATAGCAAGG - Intergenic
909191443 1:72557609-72557631 GGCACTAGAGGGAGAGAGCAAGG + Intergenic
909289513 1:73864603-73864625 GAGGCTGGAGGGTGACAGGAGGG + Intergenic
910294032 1:85626888-85626910 GAGGCTGGAAGGAGCAAGCAAGG + Intergenic
910449608 1:87331884-87331906 GCTGCTGGAAGGAAACAGCAGGG - Intronic
910576982 1:88776182-88776204 GGGGAGGGAGGGAGAGAGAAAGG - Intronic
910673069 1:89792680-89792702 GGAGCAGGAGGAAGAAAGCAAGG + Intronic
910674149 1:89800257-89800279 AGGGCTGGAGACAGACAGGAGGG + Intronic
911124702 1:94330300-94330322 AGGGCTGGAGGCTGACAGGAAGG - Intergenic
911157957 1:94655162-94655184 GGAGCTGGAGGGACGCAGCCTGG - Intergenic
911743795 1:101417004-101417026 AGGGCTGGATGCATACAGCAAGG + Intergenic
912475113 1:109929929-109929951 GGGACTAGTGGGAGAGAGCAAGG + Exonic
912956885 1:114160530-114160552 GGCGCTGGAGTGAGACTGCATGG - Intergenic
913017340 1:114752459-114752481 GGGGTTGGGGGGAGATAACAAGG - Intronic
914200037 1:145476208-145476230 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914479155 1:148049343-148049365 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
915128235 1:153680194-153680216 GGGCCAGGAGGGAGAGAGGAGGG - Intronic
915598411 1:156908063-156908085 GGGGCGGGCGGGAGACGGGAGGG + Intronic
915701695 1:157802593-157802615 GGTGATGGAGGGAGACAGGCTGG - Exonic
915729675 1:158044248-158044270 GGCTCTGGAGGCAGACAGAAGGG - Intronic
915809573 1:158892669-158892691 GGGGGTGGAGAGAGACAGACAGG + Intergenic
915974311 1:160375040-160375062 GGGGGAGGAGGGAGAGGGCAGGG + Intergenic
916202879 1:162288398-162288420 GGGGCTAGAGGGAGAGAGTGTGG + Intronic
916991591 1:170250819-170250841 GGGGCTGGAGGGGGAACTCAAGG + Intergenic
917122217 1:171654815-171654837 GGAGGTGGAGGGGGACAGGAAGG - Intergenic
918708414 1:187696875-187696897 GGGGCTGAGGGGACATAGCATGG - Intergenic
919643472 1:200067625-200067647 GGGGCTGGAGGGTGGGAGGAGGG + Intronic
919804746 1:201374967-201374989 GGGGCAGGAGGTGGGCAGCAGGG - Intronic
920085076 1:203409393-203409415 GGGGCTGGAGGAAGAAGACAAGG + Intergenic
920175088 1:204095826-204095848 AGGGCTGGAGTGAGAGAGGAAGG - Intronic
920178690 1:204119251-204119273 GGGGCTGTAGAAAGACACCATGG + Intronic
920184287 1:204150937-204150959 GGGGCTGGAGGTAGTCAGCTGGG + Intronic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920363564 1:205436106-205436128 GGGGCGGGAGGAAGGCAGGAGGG - Intronic
920455379 1:206097234-206097256 AGGGCTGCAGGGAGGCAGGAGGG - Intronic
920514738 1:206576366-206576388 AGGGATGGAGGTAGACAGCTAGG - Intronic
920534195 1:206726946-206726968 GGAGCTGGGGTGATACAGCAGGG - Intronic
921662857 1:217827872-217827894 GGGCCTGTTGGGAGAGAGCAGGG + Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
921832555 1:219744472-219744494 GGGGCTGCAGTGAGCCATCATGG - Intronic
921945038 1:220880283-220880305 GGGGCTGCAGGGCGCCAGCCCGG - Exonic
922064523 1:222124259-222124281 GGGGGTGGGGTGGGACAGCATGG - Intergenic
922184059 1:223258515-223258537 GGGGCTGGGGGGAGTCACCTGGG + Intronic
922256580 1:223897695-223897717 AGGGAAGGAGGGAAACAGCAGGG - Intergenic
922719464 1:227892996-227893018 TGGGCTGGAGGTGGTCAGCAGGG - Intergenic
922846475 1:228688982-228689004 GAGGCTCTAGGGAGACAGAATGG + Intergenic
922914326 1:229243340-229243362 GAGGAAGGAGGGAGACAGGAGGG + Intergenic
923400190 1:233609259-233609281 GGGGCTGGAAGAAGAGAGAAGGG - Intergenic
923952917 1:238980248-238980270 GAGGCTGGAGTCTGACAGCAAGG - Intergenic
924043375 1:240005487-240005509 GCTGGTAGAGGGAGACAGCAGGG - Intergenic
924509272 1:244715162-244715184 AGGGAGGGAGGGAGACAGGAAGG + Intergenic
924588608 1:245381729-245381751 GGGGCTGGTGGGAGGGAGAATGG - Intronic
924682656 1:246253261-246253283 GAGGTTGGAGGGAGGGAGCAAGG - Intronic
924738807 1:246782545-246782567 GGAGCAGGCGGGAGTCAGCATGG - Intergenic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1062959968 10:1565506-1565528 GAGGCTGAGGGGAGGCAGCAGGG + Intronic
1063161344 10:3421007-3421029 GGTGCGGGTGGGACACAGCAGGG + Intergenic
1063731347 10:8700530-8700552 GGGAGTGGAGGGAGACAGAAGGG - Intergenic
1063972004 10:11387676-11387698 AGGGCTGGAGAGAGACAGGCAGG - Intergenic
1064309628 10:14200849-14200871 GGCGTGGGAGGGAGACTGCAAGG + Intronic
1064339326 10:14472519-14472541 GGGGCTGGAGGGAGAGCCCAGGG - Intergenic
1064576943 10:16756174-16756196 GGGGCTGGAGGGAGGGGGAATGG + Intronic
1064972968 10:21084748-21084770 GGAGCAGGAGGGAGAAGGCAAGG - Intronic
1065020062 10:21496105-21496127 GGAGGTGGAGGGAGGCAGGAAGG - Intronic
1065207608 10:23372167-23372189 GGGGCTACAGGGAGGGAGCAAGG + Intergenic
1065537031 10:26724981-26725003 GCGGAGGGAGGGAGAAAGCAAGG - Intronic
1065628003 10:27650967-27650989 GGAGCAGGAGGAAGAGAGCAAGG - Intergenic
1065870554 10:29952699-29952721 GGAGCAGGAGGGAGAGAGGAGGG + Intergenic
1065920313 10:30387254-30387276 GGGGCGGGAGGAAGACCTCATGG + Intergenic
1065978308 10:30863796-30863818 GGTTCTGTAGGAAGACAGCAAGG - Intronic
1066242475 10:33551735-33551757 GGGGCTGGAGGGTGGGAGGAGGG - Intergenic
1066436142 10:35398051-35398073 GGGCATGGATGGAGGCAGCAGGG + Intronic
1067064885 10:43098239-43098261 AGGGCTTGGGGGAGACAGGATGG - Intronic
1067343406 10:45421595-45421617 GGGGGAGGAAGGAGGCAGCAAGG + Intronic
1067528848 10:47055827-47055849 GGGGCTGGAGGAACAGAACAAGG - Intergenic
1067555597 10:47267720-47267742 GGGGCAGGAGGGAGGCAGCAAGG - Intergenic
1067687144 10:48472628-48472650 TGGGCTGGAGGGAGTGAGGAAGG - Intronic
1068289693 10:54987006-54987028 GGGGCTGGGGGGCGAGTGCAGGG - Intronic
1068568970 10:58607519-58607541 AGGACAGGAGGGAGAAAGCAAGG - Intronic
1069554718 10:69390215-69390237 GGGGCTGGGTGGAGAAAGCCAGG - Intronic
1069643687 10:69974972-69974994 AGGTCAGGAGGGAGACTGCATGG - Intergenic
1069751078 10:70745318-70745340 GGTGCTGGGAGGGGACAGCAGGG + Intronic
1069959767 10:72072825-72072847 GGGTGTGGAGGGACACAGGAGGG + Intronic
1070330148 10:75410512-75410534 GGGACTACAGGGAAACAGCAAGG - Intergenic
1070354375 10:75625497-75625519 GGGGTTGGAGGGAGTCAGGGTGG + Intronic
1070393067 10:75988309-75988331 GAGGCTGGAGGGAGGAAGAAGGG - Intronic
1070398482 10:76032788-76032810 GGGGCTGATAGGAGAGAGCAAGG - Intronic
1070650146 10:78229449-78229471 GGGGCTGGGGGGAGCCTGAAGGG - Intergenic
1070780059 10:79132446-79132468 TGGGCTGGAGTGAGGCAGCAGGG + Intronic
1070852782 10:79581363-79581385 AGGGATGGAGGGAGAAAGAAAGG + Intergenic
1071503542 10:86219617-86219639 AGGGCAGGAGGGAGAGAGCTGGG + Intronic
1071519527 10:86320520-86320542 GGGGCTGGAGGAAGAAGGAATGG + Intronic
1072317818 10:94220927-94220949 GAAGCTGGAGGGAGGCAGCACGG - Intronic
1072683127 10:97521010-97521032 AGGGCAGGAGGGAGAGAGGAGGG + Intronic
1072761790 10:98062728-98062750 GCTGCTGGAGGAAGTCAGCATGG + Intergenic
1072934427 10:99698686-99698708 GGTGTTGGAGCGAGCCAGCAGGG - Exonic
1073070910 10:100792710-100792732 GGAGGGGGAGGGAGAGAGCAGGG - Intronic
1073472289 10:103730402-103730424 GGGGCTGGAAGGACACAGGTGGG - Intronic
1073476458 10:103756890-103756912 GGGGCTGGCGGGAGCTTGCACGG - Intronic
1074252261 10:111762808-111762830 AGGGCTGGAGGGAGCTAGCTAGG + Intergenic
1074866569 10:117547440-117547462 GGGGCTGGAGGAGGCCAGGAGGG - Intronic
1075090557 10:119441981-119442003 GTGGCCTGAGGGGGACAGCAGGG - Exonic
1075422278 10:122310462-122310484 GGAGGTGGAGGGAGACTGCAGGG + Intronic
1075442785 10:122493182-122493204 CTGCTTGGAGGGAGACAGCAGGG - Intronic
1075447373 10:122522739-122522761 AGCGCTAGAGGCAGACAGCATGG - Intergenic
1075553221 10:123409414-123409436 GGGGATGGAGGGAGCCAGCTAGG + Intergenic
1075642562 10:124075344-124075366 CTGGCTGGGGAGAGACAGCAGGG - Intronic
1075787055 10:125057081-125057103 GGGGCAGGAGGGAGACAGCAAGG + Intronic
1075798285 10:125136176-125136198 GGGGCTGGAGGGACCCAGGCAGG + Intronic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1075923139 10:126229646-126229668 AGGACTGGAGGGAGACAGTGGGG - Intronic
1076039773 10:127236308-127236330 GGGGAGGGAGGGAGAAAGAAAGG - Intronic
1076179031 10:128391644-128391666 GGAGCAGGAGGAAGAGAGCAAGG + Intergenic
1076189231 10:128470930-128470952 GGGGCTGGAGGGGGCGTGCAGGG - Intergenic
1076503940 10:130959404-130959426 GGGGGTGGAGTGGGGCAGCATGG - Intergenic
1076738616 10:132469562-132469584 GGGGCTGGAGGGGAAGAGCAGGG + Intergenic
1076788136 10:132761441-132761463 GGGGGTGGCAGGGGACAGCATGG + Intronic
1076788166 10:132761558-132761580 ATGGCTGGTGGGGGACAGCACGG + Intronic
1076815392 10:132912101-132912123 GGGGGTGGAGGGAGAGAGCAGGG - Intronic
1076828787 10:132983732-132983754 GGGGCTGGAGGGCGGGAGAAGGG - Intergenic
1077093175 11:788655-788677 GGGCCTGGAGGGAGACACAAGGG + Exonic
1077159344 11:1105635-1105657 GAGGCAGGAGGGAGGCAGGAGGG - Intergenic
1077191580 11:1257963-1257985 GGGCCTGGAGGGAGCCCCCAGGG + Intronic
1077216492 11:1397296-1397318 GAGGCTGCAGGGACAAAGCACGG + Intronic
1077470270 11:2755037-2755059 GGGGCTGGAGGGCGTCATTAGGG + Intronic
1077501209 11:2910529-2910551 GTGGCTGGAGGGAGGAAGAAGGG + Intronic
1077556922 11:3230405-3230427 ATCACTGGAGGGAGACAGCAGGG - Intronic
1078105750 11:8357051-8357073 CGGGAAGGAGGGAGACAGCTGGG - Intergenic
1078182106 11:9020541-9020563 GTGGGTGGAGGGAGCCTGCAGGG + Intronic
1078707590 11:13760136-13760158 GGGGCTGGAGAAAGAGAGCTGGG + Intergenic
1078750074 11:14153431-14153453 GGAGCAGGAGGAAGAGAGCAGGG + Intronic
1078894088 11:15582884-15582906 GGGACTGGATGGAGTAAGCAAGG + Intergenic
1079383325 11:19958001-19958023 GGGGTGGGAGGGAGGCAGGAAGG - Intronic
1080571203 11:33558536-33558558 GGGTCTGGAGGGAGAAGGGAAGG + Intronic
1080962267 11:37174362-37174384 GGGGCAGGAGAGAGAGAGCAAGG - Intergenic
1081001033 11:37671744-37671766 AGGGCTGGGGGGAGAGAGAAAGG + Intergenic
1081405949 11:42698076-42698098 AGGGAGGGAGGGAGGCAGCAAGG + Intergenic
1081412523 11:42776550-42776572 GGCACTGGAGGGAAACATCATGG + Intergenic
1081635675 11:44720073-44720095 GGCTCTGGAGGCAGGCAGCAGGG + Intergenic
1082870778 11:57942604-57942626 GGGGCTGCAGGGAGGGAGCAGGG - Intergenic
1083148340 11:60774712-60774734 GGGGCTGGAGGGAGTGTTCAAGG + Intronic
1083719700 11:64598212-64598234 GGGTCTGGAGGGAGGCAGGAAGG + Intronic
1083822831 11:65182360-65182382 TGGGCAGGTGGGACACAGCAGGG - Intronic
1083864398 11:65445817-65445839 GGAGCGGGAGGGGGACAGCTTGG + Intergenic
1083956688 11:65987708-65987730 GGGGAAGGAGGCAGACAGGAGGG + Intergenic
1084274272 11:68043698-68043720 CGGGCTGGGAGGTGACAGCAGGG - Intronic
1084404951 11:68966452-68966474 GGGGTTGGGGGGACACTGCAAGG - Intergenic
1084435710 11:69138124-69138146 GGGGCATGAGGGAGCCAGCAGGG + Intergenic
1084519993 11:69657196-69657218 GGAGCTGAAGGGAGATAGGAAGG - Intronic
1084563046 11:69914822-69914844 GGGCATGGAAGGAGACAGCAGGG - Intergenic
1084715658 11:70871755-70871777 GGGGCTGGGAGGGGACAGCCAGG + Intronic
1084722678 11:70917855-70917877 GGGGGTGGAGGGTGAGAGGAGGG + Intronic
1084959716 11:72710083-72710105 TGCCCAGGAGGGAGACAGCAGGG + Intronic
1084968906 11:72758817-72758839 AGGGCTGGCTGGAGACAGTAGGG - Intronic
1084979708 11:72822571-72822593 GGGGCGGGAGGCAGAACGCAAGG - Intronic
1085038037 11:73311202-73311224 GCTGCTGGATGGAGGCAGCATGG - Exonic
1085189172 11:74602912-74602934 AGGGAGGGAGGGAGCCAGCAAGG - Intronic
1085272924 11:75281018-75281040 GGTGAGGGAGGGAGACAGGATGG - Intronic
1085401134 11:76236188-76236210 GGCGCTGGAGGGGGGAAGCATGG - Intergenic
1085460054 11:76688142-76688164 TGAGCTGCAGGGTGACAGCAGGG + Intergenic
1085510710 11:77086734-77086756 AGGGCAGGAGGGAGTCAGGACGG - Intronic
1085533408 11:77204524-77204546 GGACCTGCAGGCAGACAGCAGGG - Intronic
1085681116 11:78575704-78575726 GGAGCGGGAGAGAGACAGCGAGG - Intergenic
1086092061 11:83014791-83014813 GGGGAGGGAGGGAGGCAGGAAGG + Intronic
1086151314 11:83613906-83613928 TGGGCTGGGGTGAGACATCAAGG + Intronic
1086161889 11:83731278-83731300 GGGGCTGGGGGGAGAGGGGAGGG - Intronic
1086479558 11:87219467-87219489 GGGGCTGGGGGGAGAGAGCCAGG + Intronic
1087057681 11:93949582-93949604 AGGGCAGCAGAGAGACAGCAAGG + Intergenic
1087603040 11:100339904-100339926 GAGGGTGGAGGGAGGCAGAAAGG - Intronic
1087753577 11:102031559-102031581 TGGGGTGGAGGGAGGCAGGAGGG - Intergenic
1087847316 11:102988349-102988371 GGGACTGGTGGGAGGAAGCATGG - Intergenic
1088428941 11:109736010-109736032 GGGGCTGGGGGGCAACAGGAGGG + Intergenic
1088760282 11:112922761-112922783 GGGGCTGGAGGGAGAGGAGAGGG + Intergenic
1089297777 11:117480411-117480433 GGGCCAGGAGGGTGACAGCGTGG - Intronic
1089367838 11:117931910-117931932 GGAGCTGAAGGGAGAAAGCCAGG - Intergenic
1089408451 11:118218485-118218507 GGGGGTGGAGGTAGAGAGCAGGG - Intronic
1089572053 11:119417559-119417581 GGGGCAAGAGGGGGACCGCAGGG - Exonic
1089664855 11:120011882-120011904 TGTGCTGGAGGGAGAGAGCTTGG + Intergenic
1090194024 11:124799978-124800000 GCAGCTGGAGGGAGCCGGCACGG - Exonic
1090226738 11:125076339-125076361 GGGGTAGGAGGGAGACAGTCGGG - Intronic
1090529296 11:127574184-127574206 GAGGCTGGAGGAAGGCAGTAGGG + Intergenic
1090830692 11:130419005-130419027 GGGGAGGAAGGGAGACAGGATGG - Intronic
1090839883 11:130478410-130478432 GGGGCTGAGGGGTGACACCATGG - Intergenic
1091046166 11:132327806-132327828 AGGGAGGGAGGGAGACAGGAAGG - Intronic
1091138021 11:133210372-133210394 GGGGCTGGCGGGAGAAAGAGGGG - Intronic
1091248240 11:134118570-134118592 GGGGTTGGTGGGAGACAGGCAGG - Intronic
1091335493 11:134762798-134762820 GGGGCTGCAGGGAGAAAGGAGGG + Intergenic
1091376942 12:31282-31304 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
1091593937 12:1862476-1862498 GAGGCTGCAGTGAGACAGCCTGG - Intronic
1091698090 12:2641491-2641513 GGGGCTGGAGGGAGATGTCAAGG - Intronic
1091798185 12:3309083-3309105 TGGGCTGGAGGGAGACAGTTGGG + Intergenic
1091903661 12:4165323-4165345 GGGGCTGGAGTGAGTTAGGACGG - Intergenic
1092052983 12:5486102-5486124 GTGGCAGCAGGGAGACAGGAGGG + Intronic
1092054864 12:5500433-5500455 TGGGCTGGAGGGAGCGAGGAGGG + Intronic
1092166977 12:6348333-6348355 AGGGATGAAGGGAGACAGCTTGG - Intronic
1092451632 12:8607708-8607730 GGGACTGGAGGCAGACAGACCGG - Intronic
1093045183 12:14435102-14435124 AGGGAGGGAGGGAGACAGGAAGG + Intronic
1094062102 12:26325402-26325424 AGGGCAGGAGGGATACAGCATGG - Intergenic
1094635438 12:32222755-32222777 AGGGCTGGAGGGAGCTAGCTAGG + Intronic
1095358514 12:41306461-41306483 GGGGATGGAGGGAGATGGAATGG - Intronic
1095743552 12:45632888-45632910 GGGGTTGGAGGGTTGCAGCAAGG + Intergenic
1095909269 12:47409361-47409383 GGGCCTGGAAGGACACAGAAAGG - Intergenic
1095983521 12:47985656-47985678 AGGGCTGGAAGGAGCCAGCCAGG + Intronic
1096102549 12:48978502-48978524 GGGGCGGGCGGCGGACAGCATGG - Intronic
1096429718 12:51532739-51532761 GGGGTTGGAGGGAGGCAGGAGGG + Intergenic
1096497803 12:52048634-52048656 TGGGGTGGAGGGAGACATCCTGG + Intronic
1096696948 12:53355335-53355357 GGGGAGGGAGGGAGAAAGGAAGG + Intergenic
1096741288 12:53695766-53695788 GGGGCTGCAGGGAGACAGGTGGG + Intergenic
1096846391 12:54409400-54409422 GGGCCTGGAGGGAGGGAGGAAGG - Intronic
1096976109 12:55699995-55700017 GGGGGTGGGGTGAGACACCAGGG + Intronic
1097033589 12:56106939-56106961 AGGGCTCCCGGGAGACAGCAAGG + Intronic
1097037202 12:56131730-56131752 GGGTCTGGAGGGAAAGAGCAGGG - Exonic
1097264670 12:57738324-57738346 GGGGCTGGGGGCAGCGAGCAGGG - Intronic
1097339283 12:58419131-58419153 GGAGCTGGAAGGGGACAGGAAGG - Intergenic
1097505880 12:60469238-60469260 GGGGGTGGAGGGTGAGAGGAGGG - Intergenic
1097705794 12:62866948-62866970 GAGGCAGGAGGGGGAAAGCATGG - Intronic
1098110323 12:67114797-67114819 GGGGGTGCAGAGAGAAAGCAGGG - Intergenic
1098119735 12:67223217-67223239 TGGGATGGAGGGAGAAAGAAAGG + Intergenic
1098444283 12:70550388-70550410 GAGGCAGGCGGGAGAAAGCAGGG + Intronic
1098450114 12:70610071-70610093 GGGGCTGGGGCGAGGCAGCGCGG - Intronic
1098867578 12:75780430-75780452 CTGTCTGGAGGGAGGCAGCAGGG + Intergenic
1098993103 12:77087805-77087827 TGGGCTGAAGGGATAAAGCAAGG - Intergenic
1099123821 12:78727196-78727218 GGCACTAGAGGGAGACTGCAAGG + Intergenic
1099431447 12:82591161-82591183 GGGGGTGGAGGGCTACAGGAGGG + Intergenic
1099974546 12:89532836-89532858 GGGGCTGTGGGGAGAGAGCATGG + Intergenic
1100209019 12:92381918-92381940 GGGGATGGAGGGAGGGAGGAAGG + Intergenic
1100209031 12:92381945-92381967 GGGGATGGAGGGAGGAAGGAAGG + Intergenic
1101255527 12:102973484-102973506 GGGGAGGGAGGGAGAAAGGAAGG - Intergenic
1101827775 12:108233813-108233835 GGGCATGGTGGGAGACATCAGGG + Intronic
1101863681 12:108503526-108503548 GGGGCTGGAGGGAGTGGGGATGG + Intergenic
1101916087 12:108897145-108897167 GGAGCTTGGGGGAGGCAGCAGGG - Intronic
1102590095 12:113950413-113950435 AGGCTTGGAGGGAGACAGAAAGG - Intronic
1102926395 12:116829408-116829430 GGGACTGGTGGGAGTCAGGAGGG + Intronic
1102958985 12:117079720-117079742 GGGGCTGGAGAGGGAGAACAGGG + Intronic
1103119831 12:118371978-118372000 GGGGCTGGGCTGAGACAGCGGGG - Intronic
1103212960 12:119179688-119179710 GGGGCAGGAGGGAGAGAGAATGG + Intronic
1103215522 12:119198747-119198769 GGGGCAGGAGGGAGAGAGTAGGG - Intronic
1103219188 12:119229378-119229400 GTGGCTGGAGGGAATGAGCAAGG + Intergenic
1103358966 12:120342510-120342532 AGGGCTGGAGGGAGGCGGCCAGG + Exonic
1103474707 12:121210036-121210058 GGGCCCGGAAGGAGGCAGCACGG - Intronic
1104344154 12:127980787-127980809 GGGGTGGGAAGGAGACAGTAGGG - Intergenic
1104360549 12:128129127-128129149 GGGGCGGGCGGGGGACAGAAGGG - Intergenic
1104381209 12:128309536-128309558 GGGGCTGGAGGAAAACGGAATGG - Intronic
1104463215 12:128971441-128971463 AGGGATGGAGGGAGAGAGGAAGG - Intronic
1104503753 12:129310904-129310926 GGAACTGGAGGGAGAAAGAAAGG + Intronic
1104581000 12:130010602-130010624 AGGGCATGAGGGAGAAAGCAGGG + Intergenic
1104638958 12:130455155-130455177 CGGGAGGGAGAGAGACAGCATGG + Intronic
1104845564 12:131845099-131845121 GGGCCTGCAGGGAGAGAGCCAGG - Exonic
1104872789 12:132012451-132012473 AGGGCTGGAGGGAACCAGCTTGG - Intronic
1104896960 12:132169228-132169250 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104896986 12:132169296-132169318 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104921622 12:132293657-132293679 GGAGCTGGATGGAGAAGGCAGGG + Intronic
1104944424 12:132409360-132409382 GGGGCTGGAGGGGGCAGGCAGGG - Intergenic
1104963911 12:132500646-132500668 CGGGCTGGATGGAGTCTGCAGGG - Intronic
1104963928 12:132500704-132500726 CGGGCTGGACGGAGTCTGCAGGG - Intronic
1105046229 12:133006107-133006129 GGGGCTGGGAGGGAACAGCAGGG - Intronic
1105205387 13:18218971-18218993 GGATGTGGAGGGACACAGCATGG - Intergenic
1105364276 13:19750365-19750387 GAGGCTGCAGGGAGACAATATGG + Intronic
1105896022 13:24718090-24718112 GGGGGTGGAGGGAGGGAGGAAGG + Intergenic
1106110301 13:26771324-26771346 GCAGCTGGAGGAAGCCAGCAGGG - Intergenic
1106234942 13:27853621-27853643 GGTGCTGGAGGGGCACAGCAAGG - Intergenic
1106588810 13:31080459-31080481 GGGGCTGGAGGGAGGGAGTCTGG + Intergenic
1106756089 13:32824311-32824333 GGGGCAGGATGGAGAAGGCAGGG + Intergenic
1107071408 13:36273870-36273892 GAGGCTGGAGGAAGAAACCAAGG - Intronic
1107651473 13:42549462-42549484 GGGGCTGAAAGGGGTCAGCAAGG + Intergenic
1107709892 13:43141259-43141281 GGAGCTGGATGGAGAAAACAGGG + Intergenic
1107742319 13:43464431-43464453 GGGGAAGGAGGGAGGCAGCCTGG + Intronic
1107769724 13:43776855-43776877 GGCACTGGTGGGAGACCGCAGGG - Intronic
1108322840 13:49304027-49304049 GGGGCTGGGGTGACACAGCTAGG + Intergenic
1108347397 13:49559687-49559709 GGGGCTGGGGGAGGACAGAATGG + Intronic
1108373909 13:49795861-49795883 GGGTCTCGGGGGAGACAGGAAGG + Intergenic
1108433192 13:50375531-50375553 GGGAAAGGAGGGAGACAGCCAGG - Intronic
1109760014 13:66815760-66815782 GAGGCTGGAGGGACAGAGAAGGG + Intronic
1110657221 13:78014391-78014413 GAGGCTGTAGGGAGAGAGAAAGG + Intergenic
1111770324 13:92588066-92588088 GGGGCTGGAGGGAAAGGGGAGGG - Intronic
1112254747 13:97819651-97819673 GGTGCTGGAGGGACCCTGCAAGG + Intergenic
1112356106 13:98675993-98676015 GGGGCTGCAGCGAGACTGCAGGG - Intergenic
1113343082 13:109446265-109446287 AGGGCTGGTGTTAGACAGCATGG - Intergenic
1113647327 13:112007931-112007953 GGGGCTGGAGTGAGACAGCCTGG - Intergenic
1113672774 13:112186161-112186183 AGGGCTGGAGGGAGCTAGCTTGG + Intergenic
1113703376 13:112406249-112406271 GAGCCTGGAGGGAGGCAGAAAGG - Intronic
1113786881 13:113006677-113006699 GGGGCTGGCGGGAGACACTAAGG + Intronic
1113892116 13:113741953-113741975 GGGGTTTGAGGACGACAGCATGG + Intergenic
1113893720 13:113749745-113749767 GGGGCTGGAGGGAGGCACACGGG - Intergenic
1114180691 14:20365224-20365246 AGGGCGGGAGGGAGGCAGGAAGG - Intergenic
1114533828 14:23410948-23410970 GGGGCTGGATGCAGACAGCAGGG - Intergenic
1115653354 14:35419762-35419784 GGGACAGCAGGGAGTCAGCATGG + Intergenic
1116673767 14:47878409-47878431 GGGGGTGGAGGGTGACAGAAAGG + Intergenic
1116982374 14:51185229-51185251 GTGGCAGGAGAGAGAGAGCAAGG + Intergenic
1117989025 14:61415838-61415860 AGGGCTGGAGGGAGAGGGAATGG - Intronic
1118382588 14:65229688-65229710 AGGAGTGCAGGGAGACAGCAGGG + Intergenic
1118504279 14:66393529-66393551 GGGGCTGGTGGGCCAGAGCAGGG - Intergenic
1118680434 14:68236057-68236079 GAGGGTGGAGGGAGGCAGGAGGG + Intronic
1118806207 14:69239155-69239177 GGAGAAGGAGGGAGAAAGCAAGG - Intronic
1119406186 14:74401213-74401235 AGGGCTGGGGTGAGGCAGCAGGG - Intergenic
1119744186 14:77032835-77032857 GGGGCAGGAGAGAGAGTGCAGGG - Intergenic
1119791490 14:77354076-77354098 GCGGCTAAAGGGAGCCAGCATGG - Intronic
1120635555 14:86946378-86946400 GGGACTGGAGGGAGGGAGGAAGG - Intergenic
1120856762 14:89219254-89219276 GAAGCAGGAGGGAGACAGAAGGG - Intronic
1121333325 14:93061494-93061516 GGGGCAGGAGTGAGAAAGGAGGG + Intronic
1121340223 14:93100516-93100538 GGGGCCGGGGGGAGAGAGGAGGG + Intronic
1121780451 14:96618788-96618810 GGAACTGAAGGGAGACAGAAAGG - Intergenic
1122075875 14:99234142-99234164 GGGGCTGGGGGGAGCCAGTAGGG + Intronic
1122447558 14:101781066-101781088 GTAGCTGGAGGGAGACGGCTAGG - Intronic
1122615689 14:103016353-103016375 GGTGCTGGAGGGAGACTACAAGG - Intronic
1122865906 14:104603896-104603918 GGAGCTGGAGAGAGACTGCAGGG - Intronic
1122938387 14:104970348-104970370 GGGGCTGGAGGAACAGAGCTGGG - Intronic
1123189004 14:106550072-106550094 ATGGCAGGAGAGAGACAGCAAGG - Intergenic
1123706616 15:22955452-22955474 GGGGCAGGACAGAGGCAGCATGG + Intronic
1123722798 15:23074455-23074477 GGAGCTGGAGTCTGACAGCAGGG - Intergenic
1124162604 15:27286881-27286903 GGATCTGGAGGGAGAGAGTAGGG - Intronic
1124258468 15:28165116-28165138 GGGGTTGGAGAGACACAGCCAGG + Intronic
1124420166 15:29514226-29514248 GGGGCTGGAGGGAGGGGGAAAGG - Intronic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1126056703 15:44736542-44736564 GGAGCTGGAGAGAAGCAGCAAGG - Exonic
1126345088 15:47685330-47685352 GAGGCAGGAGGGAGAGAGAAGGG + Intronic
1126592202 15:50351678-50351700 AGGGAGGGAGGGAGACAGAAAGG + Intronic
1127369208 15:58321401-58321423 GGAGCTGGAGGGAGAGAGAATGG + Intronic
1127391254 15:58506726-58506748 GGGGGCAGAGGGAGCCAGCAGGG - Intronic
1127401825 15:58594687-58594709 AGGGATGGAGGGAGAGAGGACGG + Exonic
1127691873 15:61404541-61404563 GGGGGAGGAGGCAGGCAGCAAGG - Intergenic
1128220586 15:65965546-65965568 GGGGCTGGAGGGAGCCAGTGAGG + Intronic
1128249669 15:66155469-66155491 GAGACTGGAGGAAGTCAGCAAGG - Intronic
1128692594 15:69736443-69736465 AGGGCAGGAGGTGGACAGCAGGG + Intergenic
1128983626 15:72203438-72203460 GGGGGTGGAGGGAGACAATCTGG + Intronic
1129105013 15:73301151-73301173 AGGGAAGGAGGGAGATAGCAGGG - Intronic
1129198615 15:73985462-73985484 GGGGCTGGAGGTAGACCGCGTGG - Exonic
1129217160 15:74107056-74107078 GGGACTGGGGGGAGCAAGCATGG + Intronic
1129323563 15:74787899-74787921 CGTGCTGCAGGGAGACAGGAGGG + Intronic
1129405344 15:75313308-75313330 GGGGCTGGAGGAAGACCTCATGG - Intergenic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1129519760 15:76178234-76178256 GAGGCTGGATGGAGAGGGCAGGG + Intronic
1129526131 15:76215849-76215871 GGGGCTGCTTTGAGACAGCATGG - Exonic
1129598407 15:76982728-76982750 GGAGCGGGAGGGAGAGAGCTTGG + Intergenic
1129672259 15:77613885-77613907 AGGGCTGGCGGGGGGCAGCAGGG + Exonic
1130191682 15:81742865-81742887 GGGGATGGAGGGAGGCGGAATGG - Intergenic
1130533504 15:84766212-84766234 AGGGCAAGAGGAAGACAGCAAGG - Intronic
1130603438 15:85293933-85293955 GGAGCAGGAGGGAGACAGCGGGG + Intergenic
1130945696 15:88549369-88549391 GTGGCTGCATGGAGACATCATGG + Intergenic
1131013721 15:89040666-89040688 AGGAATGGAGGGAGACAGGACGG + Intergenic
1131625797 15:94119344-94119366 TGGGCTGGAGGGGGTCAGAAGGG - Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1131662932 15:94538059-94538081 TGGGCAGGAGGAAGACAGGAAGG - Intergenic
1132117186 15:99145990-99146012 GAGGAGTGAGGGAGACAGCAAGG - Intronic
1132228031 15:100158587-100158609 GGGGCTGGAGGGAGGAGGAAGGG - Intronic
1132449978 15:101961712-101961734 GGGGCTGGAGGGAGGCGGGCGGG + Intergenic
1132496718 16:266833-266855 GGGGCTGGAGGGAGAAGGGAAGG + Intronic
1132553702 16:563856-563878 GGGGCAGGCGGGGGATAGCAGGG - Exonic
1132663403 16:1071340-1071362 GGAGCTGGAGGAACACAGCCAGG + Intergenic
1132695194 16:1198925-1198947 GGTGGGGGCGGGAGACAGCATGG - Intronic
1132748592 16:1447148-1447170 GGGGGTGCAGGGAGCCAGCTTGG - Intronic
1132756738 16:1488928-1488950 GCGGCTGGAGGGAGACTGCTGGG - Intronic
1132891783 16:2208304-2208326 GGGGCTGAAGCGACACTGCAGGG - Exonic
1133025921 16:2988914-2988936 GGGGCCGGAGGGGGAGAGGAGGG + Intergenic
1133098529 16:3464871-3464893 TGGGCTGGACGGAGCCAACAGGG - Intronic
1133101961 16:3485320-3485342 GTGGCTGCAGGCAGACACCATGG + Intronic
1133111939 16:3553023-3553045 TCTGGTGGAGGGAGACAGCACGG + Intronic
1133559035 16:6932896-6932918 GGGGCTGGGGGAAGACATAATGG - Intronic
1134911747 16:18033363-18033385 GGGGCTGGAGAGAGGGAGAATGG - Intergenic
1135504688 16:23026207-23026229 GGGACGGGAGGGAGACAGTGAGG + Intergenic
1135534627 16:23283807-23283829 AGGGCTGGAGGGACACAGGGAGG + Intronic
1136128938 16:28206793-28206815 GGGGGTGCAGGGAGATGGCAGGG - Intronic
1136135719 16:28255825-28255847 GGGGCTGGGGGGAGGCGGGAAGG + Intergenic
1136138573 16:28274045-28274067 GGGGCTGGCGGGAGAGAGGGAGG + Intergenic
1137420511 16:48329358-48329380 GGGGCGGGAGTCATACAGCATGG - Intronic
1137596192 16:49725644-49725666 GGGGCTGCAGAGGGCCAGCAGGG + Intronic
1137724736 16:50649591-50649613 GGGACTGATGGGAGACAGCATGG - Intergenic
1137866209 16:51899217-51899239 TGGGCTGTGGGGAGACAGGAGGG - Intergenic
1138106015 16:54287403-54287425 GGGGCTGAAGGGTGGCAGCCCGG + Intergenic
1138178607 16:54928400-54928422 GGGGGTGGGGGGAGAAAGCGCGG + Intergenic
1138223383 16:55272052-55272074 GGGGAGCGAGGGTGACAGCAGGG + Intergenic
1138241840 16:55433829-55433851 GGGGGAGGCGGGGGACAGCAGGG - Intronic
1138293711 16:55869259-55869281 GTGGGTGGACCGAGACAGCATGG - Intronic
1138370734 16:56524525-56524547 AGGCCTGGAGGGAGGCAGCGTGG + Intergenic
1138417386 16:56879263-56879285 GGGGCTGGGTGGAGGCTGCAGGG + Intronic
1138428979 16:56955794-56955816 GAGGCTGGAGGAAGAGAGAACGG - Intergenic
1138436684 16:57004703-57004725 TGGGCTGCAGGGAGAGAACAAGG + Intronic
1138504780 16:57472823-57472845 GGGCCTGGAGTGACACAGGAAGG - Exonic
1138535113 16:57655843-57655865 GGGGTTGGAGGAAGAGAGTAGGG - Intronic
1138554341 16:57763114-57763136 CTGGCTGTGGGGAGACAGCAGGG - Intronic
1138606889 16:58095325-58095347 GGGGGTGGTGGCAGACAGCTGGG + Intergenic
1138627573 16:58264727-58264749 GGGGTGGGAGGGTGACAGGAGGG + Intronic
1138635064 16:58331629-58331651 GGGGGTGGAGCCAGACAGGAAGG - Intronic
1138656179 16:58492866-58492888 GGGGCTGGAGGGGGAGGACAAGG - Intronic
1139390451 16:66604270-66604292 GGGGCTGGCCGGGGACAGGAGGG + Exonic
1139602940 16:67997838-67997860 AGGGTTGGTGGGAGACAGTAAGG + Intronic
1139614686 16:68081794-68081816 GGGGGTGGAGGGGGACAGTCAGG + Intergenic
1139841561 16:69885669-69885691 GGCTCTGGAGGCAGACACCAGGG + Intronic
1141429136 16:83961869-83961891 AGGGCTGAAGGGAGACCACAAGG - Intronic
1141495134 16:84404342-84404364 GAGGCTGGAGGGAGAGGGAATGG - Intronic
1141627073 16:85266950-85266972 GGGACAGGAGGGAGCCTGCAGGG + Intergenic
1141666304 16:85467211-85467233 GGGGCCGGAGCGAGCCAGCCTGG + Intergenic
1141793560 16:86252985-86253007 GGGGGTGGAGGGGTGCAGCATGG - Intergenic
1141820550 16:86442537-86442559 GTGCCAGGAGGGAGGCAGCATGG - Intergenic
1142102985 16:88285420-88285442 GGGGCTGTGGGGAGACAGTGTGG + Intergenic
1142161637 16:88560821-88560843 GGGGTGGGAGGGAATCAGCAGGG - Intergenic
1142186572 16:88697659-88697681 CGGGCTCGAGGGAGACAGGAAGG + Intronic
1142228705 16:88889402-88889424 GGGGCGGGAGGGAGGGAGCGAGG + Intronic
1142300496 16:89255050-89255072 GGGGCTGGAGGTGAACAGCGAGG + Intergenic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142356392 16:89603875-89603897 GGGGCTGGAGGGAAGCAGTGGGG + Intergenic
1142359198 16:89618915-89618937 GGAGCTGCAGGGAGGGAGCAGGG - Intronic
1142359335 16:89619220-89619242 GGGGCTGCAGGGAGGGAGCAGGG - Intronic
1142722248 17:1784291-1784313 GGGGCTGGAGGACCAAAGCAGGG + Intronic
1142759436 17:2034555-2034577 GGGGAGGGAGGGTGGCAGCAGGG - Intronic
1142814376 17:2413809-2413831 GGGGCTGCAGTGATACAACACGG - Intronic
1142977063 17:3651524-3651546 GAGGCTGGAGGAAGCAAGCAGGG + Intronic
1143416817 17:6756534-6756556 GGGGCAGGGGGGACAGAGCAGGG + Intronic
1143524551 17:7464470-7464492 GGGGCTGGAGGGAGGCAGACCGG + Intronic
1143658746 17:8312234-8312256 GGGGCTTGAGGGATGCAGCTGGG - Exonic
1143844265 17:9760923-9760945 GGGTCTGGAGGAAGACAGCTGGG + Intergenic
1143923090 17:10346433-10346455 GGAGCTGGAGGGAGGCTGCCTGG + Intronic
1143991162 17:10963443-10963465 GGGGCTGGAGAGAAGGAGCATGG + Intergenic
1144174899 17:12695843-12695865 GGGGCTGGGGGAAGAGAGAATGG - Intronic
1144846807 17:18224551-18224573 GTGGGTGGAGGGGGACAGCCAGG + Intergenic
1144945343 17:18966873-18966895 GGGGCTGCAGGGTGCCGGCAGGG + Intronic
1144947843 17:18978888-18978910 GGGGCTGGGCGGAGGAAGCAGGG - Intronic
1144952168 17:19000217-19000239 AGGGCTGGAGGGAGGCTGGAGGG + Intronic
1145301922 17:21646763-21646785 GGGGCTGAATGGAGCCAGAAGGG + Intergenic
1145914480 17:28563561-28563583 GGGGCTGGGGGGAGATGGAATGG - Intronic
1146095752 17:29929375-29929397 GGGGCAGGCGGGAGAAACCAAGG + Intronic
1146095987 17:29930430-29930452 GGGGCCGAAGGGAGCCAGCCCGG + Intronic
1146821119 17:35984290-35984312 GGGGGGAGAGGGAGCCAGCAGGG - Intronic
1147184323 17:38705398-38705420 GGGGCATGAGGGCGAGAGCACGG + Intergenic
1147431109 17:40371356-40371378 AGAGCGAGAGGGAGACAGCATGG - Intergenic
1147614362 17:41819596-41819618 GGGGCTGCAGGGTGCCTGCATGG + Exonic
1147671546 17:42179846-42179868 GGAGCTGGAGGGAGACAGCTCGG - Intronic
1147915622 17:43883521-43883543 GGGGAAGAAAGGAGACAGCAAGG - Intronic
1147953777 17:44121418-44121440 GGGGGAAGGGGGAGACAGCAAGG - Intronic
1148025683 17:44585999-44586021 GAGGCTGGAGGAAGACAACCTGG + Intergenic
1148339611 17:46865487-46865509 GGGGATGGAGGGTGAGAGCTGGG + Intronic
1148558768 17:48594104-48594126 GAGCCTGCAGGGAGCCAGCAGGG - Intronic
1148718499 17:49733127-49733149 GGTGCTGGAGGGAGGAAGAAGGG - Intronic
1148982066 17:51585709-51585731 GGCACTGGAGGGATACTGCAAGG + Intergenic
1149127864 17:53257069-53257091 TGGGCTGTAGTGTGACAGCATGG - Intergenic
1149186301 17:54001710-54001732 GTGGCTGGAGGGAGGCTACATGG - Intergenic
1149269112 17:54957136-54957158 GGGGCTGGAAGCAGATAGGAGGG - Intronic
1149347562 17:55753563-55753585 AGGACTGGAGGCAGACAGCTGGG - Intronic
1149420710 17:56508436-56508458 GGGGCTGGAGGAAGGGTGCATGG - Intronic
1149456852 17:56794986-56795008 GGGAGTGGTGGGGGACAGCATGG - Intronic
1149561708 17:57612097-57612119 GGGCCTGGGGGAGGACAGCAGGG + Intronic
1149993951 17:61397293-61397315 GGGGCTGGAGGGGGAGGGCGCGG - Intergenic
1150211537 17:63444650-63444672 GGGGCTGGAAGAACACAGGATGG + Intronic
1150245060 17:63668537-63668559 GGGGATGGAGGTGGGCAGCATGG + Intronic
1150517134 17:65825527-65825549 GGGGCTAGAGGGAGAGAAAATGG + Intronic
1151448382 17:74182019-74182041 GGGGTTGCAGGGAAACAGGAGGG - Intergenic
1151466502 17:74289159-74289181 AGGGCTGGAGGGCAACAGGAAGG - Intronic
1151734591 17:75931201-75931223 GGAGGTGGAGGGAAACAGCCAGG + Intronic
1151842276 17:76626999-76627021 GGGGCTGGAGGGGGGCTGGAGGG + Intronic
1152238115 17:79148912-79148934 GGGGATGGAGGGGGACAGCCTGG + Intronic
1152287899 17:79423076-79423098 GGGGCTGGAGGCAGAAAGAGGGG - Intronic
1152312322 17:79558767-79558789 GGAGCAGGAGGGAGAGAGGAGGG + Intergenic
1152343368 17:79737498-79737520 GGGGCTGGAGGGAGCGAGGGTGG + Intronic
1152475151 17:80513110-80513132 GGGGCACGAGGGTGACATCAGGG - Intergenic
1152495350 17:80667240-80667262 GAGGCTGGAGGGGGACAGCCGGG + Intronic
1152649602 17:81486219-81486241 GGGGTTGGGGGGAGAGGGCAAGG - Intergenic
1152773885 17:82187789-82187811 GGGGCTGGGGGGAGCTGGCAGGG + Intronic
1152811116 17:82383298-82383320 GGGGGTGGAGGGACATGGCAGGG - Intergenic
1152812198 17:82387229-82387251 GGGGCTGGGAGCAGACAGGAAGG + Intergenic
1152816112 17:82408981-82409003 GGAGCTGCCGGGAAACAGCAGGG - Intronic
1152861476 17:82698838-82698860 GGGGCGGGTGGGCGACAGCCCGG - Intergenic
1154053628 18:10988918-10988940 GGGGCTGGGGGTGGAGAGCAGGG + Intronic
1154304998 18:13224063-13224085 GGGGAGGGAGGGCTACAGCACGG - Intronic
1154402828 18:14058026-14058048 GAGGTGGGAGGGAGGCAGCAAGG - Intronic
1155293936 18:24368594-24368616 AGGGATAGAGGGAGACAGGACGG + Intronic
1156067866 18:33166921-33166943 GAGGGTGGAGGGAGGCAGGAGGG - Intronic
1156293504 18:35770437-35770459 GGGGCTGGGAGGATGCAGCATGG - Intergenic
1156485336 18:37462115-37462137 GGTGCTCCAGGGAGTCAGCAGGG - Intronic
1156518614 18:37702159-37702181 GAGGCTGGTGGCAGACAGGAAGG + Intergenic
1156545586 18:37960852-37960874 GGAGCAGGAGCAAGACAGCAAGG + Intergenic
1156997283 18:43482962-43482984 GGGTCTGTAGGGAAACAGGATGG + Intergenic
1157730353 18:49998832-49998854 GGGGCTGGAGGAAGGGAGAATGG + Intronic
1158187292 18:54785007-54785029 GTGGCTGGAGGCATACACCAAGG - Intronic
1158475001 18:57772292-57772314 AGGGATGGAGAGAGACAGGAGGG + Intronic
1158489655 18:57898513-57898535 GGGCCTGGAGGAAGGTAGCAGGG + Intergenic
1158500114 18:57993436-57993458 GTGGCTAGAGGGAGAACGCAAGG + Intergenic
1158847303 18:61458172-61458194 GAGGATGGAGGGACACAGGAAGG - Intronic
1159001028 18:62975286-62975308 GGGCCAGGAAGGAGACAGCTGGG - Intronic
1159034951 18:63267817-63267839 AGGGAAGGAGGGAGAGAGCAGGG - Intronic
1159452384 18:68618955-68618977 GGGTTTGGAGGGAGAAAGTAAGG + Intergenic
1159817249 18:73090562-73090584 GAGGGTGGAGGGAGAAAACAGGG + Intergenic
1159871558 18:73763930-73763952 AGGACTGGAGGCAGTCAGCAAGG + Intergenic
1159909972 18:74136592-74136614 GGGGCTTCAAGGAGACACCAAGG + Intronic
1160034794 18:75290588-75290610 GGGGCTGGGGGGAGAAGCCAGGG - Intergenic
1160044859 18:75377066-75377088 GAGGCTGGAGGGACAAAGGAAGG - Intergenic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1160589291 18:79933713-79933735 GAAGCAGGAGGGAGACAGGAAGG - Intronic
1160635276 19:70836-70858 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1160749746 19:728178-728200 GGGGCAGGAAGGGGACAGGATGG + Intronic
1160822782 19:1066222-1066244 GGTTCTGGAAGGGGACAGCAGGG + Intronic
1160939946 19:1615542-1615564 GGGGCCAGAGGGAGACAGTGAGG + Intronic
1161220370 19:3115617-3115639 GGGCCTGGTTGGAGCCAGCATGG + Intronic
1161299769 19:3537099-3537121 GGGCCAGGAGGGACAGAGCAAGG + Intronic
1161610617 19:5240337-5240359 GGGGGTGCAGGGAGACAACTAGG + Intronic
1161850519 19:6735854-6735876 GGGGCTGGAGGGAGGGGGTAGGG - Intronic
1161985085 19:7648682-7648704 GGGGCTGGGAGGAGAAAGCAGGG - Intergenic
1162128812 19:8513145-8513167 GGGGCTGGAGGGATGCAGCAGGG - Exonic
1162300685 19:9843154-9843176 GGGCCTGGAGGGTCCCAGCAAGG + Intronic
1162551868 19:11362394-11362416 GGGGCTGGAGGGAGTGGCCAGGG - Intronic
1162967022 19:14160879-14160901 GGGGCAGGAGGGAGAGCTCAGGG - Intronic
1163011711 19:14430778-14430800 GTGGCTGGAAGGAGTGAGCAAGG + Intergenic
1163575930 19:18110678-18110700 GGGGCTGCTGGGACCCAGCAGGG - Intronic
1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG + Exonic
1163750877 19:19076789-19076811 GGGGCAGGAAGGAGCCAGCTGGG - Intronic
1164637220 19:29800319-29800341 GGCGTGGGTGGGAGACAGCAGGG + Intergenic
1164886608 19:31783733-31783755 GGGCCTGGTGGGAGACGGCAGGG - Intergenic
1165250899 19:34533246-34533268 GGGGCTAGAGGCAGAGAGGAAGG - Intergenic
1165333429 19:35154061-35154083 AGGCCTGGAGAGGGACAGCAGGG - Exonic
1165443863 19:35845954-35845976 GGGGCGGGAGGGACAGAGCCAGG - Intronic
1165465967 19:35975016-35975038 GGGGATGGAGAAAGACAGGAAGG - Intergenic
1165843629 19:38804147-38804169 GGGACAGCAGGAAGACAGCAAGG - Intronic
1166343140 19:42150544-42150566 GGGGCTGGAGGGGGCCGGCAGGG + Intronic
1166390509 19:42406635-42406657 GGGGCTGGAGGTTGGGAGCAGGG + Intronic
1166439268 19:42797080-42797102 GGAGCTGGAGGAAGAGAGCAAGG + Intronic
1166457309 19:42952629-42952651 GGAGCTGGAGGAAGAGAGCAAGG + Intronic
1166467640 19:43047059-43047081 GGAGCTGGAGGAAGAGAACAAGG + Intronic
1166494897 19:43293405-43293427 GGAGCTGGAGGAAGAGAGCAAGG + Intergenic
1166498407 19:43323266-43323288 AGAGCAGGAGGAAGACAGCAAGG + Intergenic
1166520210 19:43475167-43475189 GGGGCAGGAGGAAGATTGCAGGG - Exonic
1166524690 19:43503879-43503901 GGGGCCCGAGGGCGACAGCGCGG - Intronic
1166524981 19:43504958-43504980 GGGGCTCGAGGGAGACTGGGAGG - Intergenic
1166541400 19:43608104-43608126 GGGCCTGGAGGGGGACAGACAGG + Exonic
1166581654 19:43905710-43905732 GGAGCAGGAGGAAGAGAGCAAGG - Intergenic
1166633293 19:44427032-44427054 GGGACAGGAGAGAGACAGCGAGG + Exonic
1166670250 19:44705562-44705584 GGGGCAGGAGGGAGATAGATGGG - Intronic
1166824272 19:45599436-45599458 GGGGCTGCAGGGAGAAGGCGGGG - Intronic
1166871802 19:45875612-45875634 GGGGCTGGAGTGAGTGGGCAAGG + Intergenic
1167044379 19:47041165-47041187 GGAGGTGGGGAGAGACAGCAGGG - Intronic
1167124229 19:47538403-47538425 CGGGGAGGAGCGAGACAGCAAGG - Exonic
1167295264 19:48645873-48645895 GGAGCTAGAGGGAGACTGGAGGG - Exonic
1167321392 19:48799200-48799222 AGGGCAGGAAGGAGACAGCTGGG - Intronic
1167422462 19:49412307-49412329 TGGGGTGGAGGGACAGAGCAGGG + Intronic
1167464017 19:49640743-49640765 GGCCCTAGAGGGGGACAGCAGGG + Intergenic
1167668619 19:50837066-50837088 GGGTCTGGATCCAGACAGCATGG + Intronic
1167743646 19:51339032-51339054 GGAACTGCAGGGAGGCAGCAGGG + Exonic
1167781862 19:51603580-51603602 GGGGCTGGAGACAGAAATCATGG + Intergenic
1167958510 19:53087226-53087248 GGGGCTGGGAGGACACAGGAAGG + Intronic
1168306527 19:55438912-55438934 GGAGGTGGAGGGAGGTAGCAAGG - Intronic
1168316283 19:55486101-55486123 GAGGCTGGAGGGAGGCTGCTGGG - Intronic
1168316876 19:55488407-55488429 GAGGCTGCAGGGAGGCGGCAGGG - Intronic
1168405464 19:56108203-56108225 GGGGCTGGGTGGAGAGAGCGGGG - Intronic
1168563500 19:57403594-57403616 GGGGCTGGTGGAAGGCAGGAGGG - Intronic
925057560 2:866866-866888 AGGGCTGGAGGCAGAGAGGAAGG - Intergenic
925281963 2:2691050-2691072 GGGGAGGGAGTGAGACAGAAGGG - Intergenic
925419905 2:3703579-3703601 GGGGCTGGACGGGGACGGGACGG - Exonic
925753644 2:7111780-7111802 GTGGCAGGAGAGAGAGAGCAGGG - Intergenic
925793847 2:7521626-7521648 GTGGCTGGAGGGAAAAGGCAAGG + Intergenic
926171081 2:10552982-10553004 GGGGCCGGAGACAGACAGCAGGG + Intergenic
926228523 2:10985437-10985459 GGGACTGGAAGCAGCCAGCAGGG + Intergenic
926609019 2:14926767-14926789 GGGGCTGAGGGGAGAGAGAATGG - Intergenic
926679402 2:15652469-15652491 GGGGCTGCAGGGAGAGACCATGG - Intergenic
926868637 2:17387926-17387948 AGGGCTGGAAGCAGACAGAAAGG + Intergenic
926988320 2:18648442-18648464 GGGGCTGGGGGAGGCCAGCATGG - Intergenic
927518368 2:23685170-23685192 AGGGCAGGAGGGAGGGAGCAAGG - Intronic
927566618 2:24119164-24119186 AGGGGAGGGGGGAGACAGCAGGG - Intronic
927653280 2:24925051-24925073 GGGGCAGAAGGGAGAGACCAGGG - Intergenic
927877633 2:26669472-26669494 AGGGATGGAGGGAGAGAGGAAGG - Intergenic
927878727 2:26675790-26675812 CAGGCTGGAGTGACACAGCATGG - Intergenic
927884807 2:26711862-26711884 GGGGCTGGGGGGAGGGAGCAGGG + Intronic
928314502 2:30235191-30235213 GGGGCAGTAGAGAGGCAGCAGGG - Intronic
928367167 2:30711761-30711783 GGTGCTAGAGGGAAACTGCAAGG + Intergenic
928441863 2:31298801-31298823 GGGGCTGGAGGGAGATGGGATGG + Intergenic
928477355 2:31643015-31643037 TGGGCAGGAGGGACACTGCATGG + Intergenic
929021979 2:37562439-37562461 GGGTGGGGAGGCAGACAGCACGG + Intergenic
929151254 2:38751054-38751076 GGTGCTGAAGGGAGACGGGATGG - Intronic
929564381 2:42975438-42975460 AGGGCTGGAGGAAGACAGGAAGG - Intergenic
930697642 2:54428248-54428270 GTGGCTGGAAGGAAACAACAGGG + Intergenic
931140584 2:59453208-59453230 AGGGCTGGAGGGAGCTAGCTAGG + Intergenic
931645052 2:64414621-64414643 GGGGCTGGAGGGTAAAAGAAGGG - Intergenic
931763660 2:65436476-65436498 GGGGCTTGGGGGAGACAGCTGGG - Intergenic
932073782 2:68644760-68644782 GGGACTGCAGGGAGAGAGCAGGG + Intronic
932116638 2:69056125-69056147 TTGTCTGGATGGAGACAGCAAGG + Intronic
932554234 2:72805779-72805801 GAGGCTGGAGGAGGACAGAATGG - Intronic
932570210 2:72934513-72934535 GGAGCTGGAGGTAGAGACCAGGG - Exonic
932574717 2:72956304-72956326 GGGGCTGGAGGGAGGCTAAAGGG - Intronic
932597482 2:73103091-73103113 GTGGATGCGGGGAGACAGCAGGG - Intronic
933264530 2:80168192-80168214 GAGGCTGGAGGGGGAAAGAAAGG - Intronic
933638638 2:84735037-84735059 GCAGATGGAGGGAGGCAGCAAGG - Intronic
933698289 2:85236496-85236518 GGGGCTCCAGGGACACACCAGGG - Intronic
933727204 2:85433720-85433742 GGGGGTGGTGAGAGGCAGCAAGG - Intronic
933747079 2:85579188-85579210 GGGGCTGGAGGAAAACAGGGAGG + Intronic
933858594 2:86441949-86441971 GGGGCCGGGCGGAGACAGCAGGG - Intronic
934475137 2:94588560-94588582 GGGGCTGGAGGGTGAGAAGAGGG - Intronic
934581596 2:95445376-95445398 GGTCCTGGAGGGATACTGCAGGG + Intergenic
934597854 2:95631338-95631360 GGTCCTGGAGGGATACTGCAGGG - Intergenic
934662093 2:96148514-96148536 GGGGCTGGAAGGAGGAAGGAAGG - Intergenic
934947134 2:98550191-98550213 GGAGCAGGGGGGAGACGGCAAGG - Intronic
935213280 2:100956355-100956377 GAGGCTGGAGGGAGGAAGGAAGG - Intronic
935349381 2:102140693-102140715 GGGGATGGAGTGAGACAGGCAGG + Intronic
935519747 2:104090029-104090051 GGGGGTGGAGGGTGAGAGGAGGG + Intergenic
935636410 2:105252512-105252534 TTGGCTGGAGGGAAACCGCATGG - Intergenic
935796043 2:106642396-106642418 GGGGAAGGAGGGAGACGGGAAGG - Intergenic
935899094 2:107771225-107771247 AGGGATGGAGGGAGGAAGCAAGG + Intergenic
936279264 2:111123136-111123158 GGAGCGGGAGGGAGGGAGCACGG + Intronic
936566204 2:113584207-113584229 GGGGCTGGAGGGAGGCGGGCGGG + Intergenic
936968671 2:118152625-118152647 GGGGATGGAGGGAGAGAATAAGG + Intergenic
937017594 2:118619938-118619960 GGGGCTGCTGGGTGACAGCAGGG - Intergenic
937103387 2:119288879-119288901 GGGGCTGGAGTGACTCACCAAGG - Intergenic
937146015 2:119645330-119645352 GGGGCTGGAGGGAGGTGGGAGGG - Intronic
937236985 2:120437029-120437051 AGGGCTGGGGGAAGGCAGCAGGG + Intergenic
937293017 2:120793408-120793430 GGGGCTGCCTGGGGACAGCAGGG - Intronic
937452280 2:122011460-122011482 GGGGCAGGGGAGAGACAGCAAGG + Intergenic
937457584 2:122055782-122055804 GGGGCTGGTGGGGGAAAGGAGGG - Intergenic
938067937 2:128292054-128292076 GGGCCTGGATGGAGCCGGCAGGG + Intronic
938125727 2:128669954-128669976 GTGGCTGCAGGGAGGCAGCCGGG + Intergenic
938399284 2:130975596-130975618 GGGACTGGAGGCAGGGAGCAGGG - Intronic
938554138 2:132408599-132408621 GGGGAGGGAGGGAGAAAGGAAGG + Intergenic
938841398 2:135168324-135168346 CGGGCTGGAGACAGACAGGAGGG - Intronic
939629701 2:144516992-144517014 GGGGCTCGAGGGGGGCAGCGGGG + Intronic
939733848 2:145819308-145819330 GGGGATGGAGGGAGGAAGGAAGG - Intergenic
940628661 2:156209582-156209604 GAGGGTGGAGGGTGACAGGAAGG - Intergenic
940865878 2:158817481-158817503 GGGGCTAGATGGAGGCAGGAAGG + Intronic
941236618 2:162983294-162983316 GGGGATGGAGGTAGTCAGCTTGG + Intergenic
941384749 2:164840692-164840714 GCGGGTGGAGGGCGACAGGAGGG - Intronic
941634817 2:167925070-167925092 GGTTCTGGAGGGAAACAGAATGG - Intergenic
942013426 2:171787759-171787781 GGGGCTGGAGCCATACAGAATGG - Intronic
942073671 2:172337418-172337440 GGGGCGGGAGTGAGGCTGCAGGG + Intergenic
942209244 2:173654226-173654248 GTGGCAGGAGAGAGACGGCAGGG - Intergenic
942571912 2:177323542-177323564 GGGGCTTGAAGGAAACAGGAAGG - Intronic
942884868 2:180911039-180911061 GGTGCTAGAGAGAGACTGCAAGG + Intergenic
945064437 2:205936725-205936747 GGGGCCGGAGGGAAAGAGGAAGG + Intergenic
946334817 2:219029645-219029667 AGTGCTGCAGGGACACAGCAGGG + Exonic
946360149 2:219214495-219214517 AGGGCTGGAGAGTGACAGGATGG + Exonic
946877086 2:224140101-224140123 GAGGCTGGAGGGTGAGAGGAGGG - Intergenic
947077764 2:226364034-226364056 AGGGAAGGAGGGAGACAGGAAGG + Intergenic
947434739 2:230063402-230063424 GAGGCTGGAAGGAGAGAGGAGGG - Intronic
947863880 2:233382524-233382546 GGGGCTGCAGGCAGACAGCTGGG - Intronic
947909700 2:233792935-233792957 GGCGCCGGAGGGAGACTGCTGGG + Intronic
947926690 2:233927604-233927626 GGGGTTGAAGGAAGAGAGCAAGG - Intronic
947959094 2:234219686-234219708 GGGGATGGAGGGAGAGACCCAGG - Intergenic
948086779 2:235257014-235257036 GGGGCTGTGGGGAGGTAGCAGGG - Intergenic
948141785 2:235678723-235678745 GGGGCGGGAGGGAGGCAGGCAGG - Intronic
948453251 2:238091823-238091845 AGGGATAGAGGGTGACAGCAGGG - Intronic
948566643 2:238891531-238891553 GGAGCTGGAGGGTGAGAGGACGG + Intronic
948765581 2:240217104-240217126 GGGGGTGGAGGGACAGAGCATGG + Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
948981282 2:241496187-241496209 GGGGCTGGAGAGAGTGGGCAGGG - Intronic
949079775 2:242087991-242088013 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1168856647 20:1013569-1013591 GGGGCTGCAGGGAGGCAGTGAGG - Intergenic
1168961230 20:1871435-1871457 GGGGCTGGAAGGTGGGAGCAGGG - Intergenic
1169204076 20:3730387-3730409 GGAGCAGGAGGGAGACGGGAGGG + Intergenic
1169581316 20:7026370-7026392 GGAGGTGGAGGGAGATAGCAGGG + Intergenic
1171018299 20:21561600-21561622 GGGGCGGGTGAGAGCCAGCAGGG - Intergenic
1171209924 20:23309296-23309318 GGAGGAGGAGGGAGACAGGAGGG - Intergenic
1171393712 20:24817553-24817575 GAGGCTGAGGGGAGCCAGCAGGG - Intergenic
1172108134 20:32528678-32528700 GGGGCTGCAGGGAAACCACAGGG + Intronic
1172162135 20:32876071-32876093 GGTGCTGGAGGGAGGCTGGAGGG + Intronic
1172166036 20:32899975-32899997 GGGGCCGGAGGAAAACTGCAGGG - Intronic
1172192119 20:33068473-33068495 GAGTCTGGAGGGAGAACGCAGGG + Intronic
1172321249 20:33996785-33996807 GGGGCTGGAGGGAGGAGGGAAGG - Intronic
1172408175 20:34704487-34704509 GGGGCGGGAGGGGGGCGGCACGG - Exonic
1172587353 20:36093836-36093858 GGGGCTGGGGGGAGGCCGGAGGG - Intronic
1172843015 20:37913436-37913458 AGGGCTGCAGGGAGAGAGAAAGG - Intronic
1173111363 20:40193435-40193457 GAGGATAGAGGGAGACAGGAAGG - Intergenic
1173233865 20:41225915-41225937 GGGGCTGGGGGAAGAGAGTAAGG - Intronic
1173522406 20:43709790-43709812 GGGGCTCGGGGGAAACAGAAGGG - Intronic
1173645646 20:44631620-44631642 GGGGCTGGAGGGAGACCATTAGG - Intronic
1173749899 20:45468943-45468965 GGGCCTGGAGGGAGAGACCTGGG + Intergenic
1173983974 20:47246837-47246859 AGGGCTGGAAGGGAACAGCAGGG + Intronic
1174192057 20:48747647-48747669 GGGGCTGAAGGGAGCAAGCTGGG + Intronic
1174392168 20:50224381-50224403 GGGGGTGGTGGGGGACAGGAGGG + Intergenic
1174612197 20:51807142-51807164 GGGGCTGGAGGGAGGGAGAGTGG + Intergenic
1175011061 20:55736531-55736553 GAGGGTGGAGGGAGGCAGGAGGG + Intergenic
1175063252 20:56263157-56263179 TGGGCTTGGGGGAGGCAGCAGGG + Intergenic
1175222436 20:57425203-57425225 GGGGGTGGGGGGAAGCAGCAGGG + Intergenic
1175249163 20:57598364-57598386 GGGGCTGGGAGGTGACAGCCAGG + Intergenic
1175368634 20:58471868-58471890 GGGGCTGGAGTGGGTCAGGAGGG + Intronic
1175394935 20:58651338-58651360 CGGCCTGCAGGAAGACAGCAGGG - Exonic
1175473510 20:59251620-59251642 GGGGATGAAGGGAGACCCCAGGG + Intronic
1175501168 20:59452258-59452280 AGGTCTGGAGAGAGACAGGAAGG - Intergenic
1175573621 20:60042831-60042853 GGGGTGGGAGGGAGGCAGGAAGG + Intergenic
1175717178 20:61262873-61262895 AGGGAGGGAGGGAGAGAGCAAGG - Intronic
1175755700 20:61528410-61528432 GGGGGTGGAGGGGGAGAGGAGGG + Intronic
1175923236 20:62459587-62459609 AGGGCGGGAGGGAGGCAGGACGG - Intergenic
1175964667 20:62654538-62654560 GTGGCTGGAAGGAGACCCCAAGG + Intronic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1176658161 21:9607064-9607086 GGGGCTGGGGGAAGGCAGAATGG + Intergenic
1176708125 21:10129944-10129966 GGAGGAGGAGGGAGACAGAAGGG + Intergenic
1178136441 21:29633074-29633096 GGGGCTGGAGGGAATTAGCTAGG + Intronic
1178354618 21:31900230-31900252 GGGGCTGGAAGGAGCTAGGAGGG - Intronic
1178586468 21:33875102-33875124 GGGGCTGGACTGAGACCTCAAGG + Intronic
1178694485 21:34781177-34781199 AGGGCTGGAGGGAACCAGCCAGG - Intergenic
1179715667 21:43286313-43286335 GGGGCTGGAGGCTGAGATCAAGG - Intergenic
1179788844 21:43744026-43744048 GTGGCTGGTGTGAGACAGGAAGG + Intronic
1179915623 21:44476277-44476299 GTGGCAGGAGAGAGAGAGCAAGG - Intergenic
1179923485 21:44520278-44520300 GGGGCTGGGAGTAGGCAGCAGGG - Intronic
1179952373 21:44716103-44716125 GGAGCAGGAGAGAGAGAGCAAGG - Intergenic
1180162749 21:46005654-46005676 TGGGCTGGAGGAGGGCAGCAGGG + Intergenic
1180760588 22:18199747-18199769 GGATGTGGAGGGACACAGCATGG + Intergenic
1180770902 22:18384044-18384066 GGATGTGGAGGGACACAGCATGG + Intergenic
1180775080 22:18424949-18424971 GGATGTGGAGGGACACAGCATGG - Intergenic
1180783801 22:18535945-18535967 GGGCCTGGGGAGAGACAGGAGGG + Intergenic
1180808155 22:18736004-18736026 GGATGTGGAGGGACACAGCATGG - Intergenic
1180937807 22:19637605-19637627 GGGGCAGGAGGGAGTCAGCCTGG - Intergenic
1181006232 22:20014962-20014984 GGGACTGGGGGGAGACTACAGGG + Intronic
1181088328 22:20455264-20455286 GGAGCTGGAGGGAGATGGGAGGG - Intronic
1181146253 22:20849985-20850007 AGGGCTGCAGGGTAACAGCAAGG + Intronic
1181194150 22:21169918-21169940 GGATGTGGAGGGACACAGCATGG - Intergenic
1181215291 22:21322860-21322882 GGATGTGGAGGGACACAGCATGG + Intergenic
1181240701 22:21475297-21475319 GGGCCTGGGGAGAGACAGGAGGG + Intergenic
1181319061 22:21990803-21990825 GGGGCTGTTGGGAGACTGGAAGG - Intergenic
1181522501 22:23457700-23457722 GGGGGTGGACGGAGACAGGCAGG - Intergenic
1181762467 22:25067677-25067699 GGGGCTGGAAGGAGGCAGACAGG - Intronic
1181866231 22:25857625-25857647 CAAACTGGAGGGAGACAGCAAGG - Intronic
1181964318 22:26645950-26645972 GGGACAGGAGGGACAAAGCAAGG + Intergenic
1182031566 22:27163186-27163208 AGGGAAGGAGGGAGAGAGCAAGG + Intergenic
1182104980 22:27682749-27682771 GGGGCTGGATGCAGACTGGAGGG - Intergenic
1182129690 22:27841945-27841967 GGCACTGGAGAGAGAAAGCATGG + Intergenic
1182235210 22:28869778-28869800 GGGGAGGGAGGGAGACAGTATGG + Intergenic
1182435154 22:30325785-30325807 GGGCAGGCAGGGAGACAGCAGGG - Intronic
1182470893 22:30547566-30547588 GGGACTTCTGGGAGACAGCAGGG + Intergenic
1183160688 22:36110986-36111008 GAGGCTGCAGTGAGACAGGATGG - Intergenic
1183238785 22:36640336-36640358 AGGGCTGGAGGGAGATTACAAGG + Intronic
1183269743 22:36853670-36853692 GGCGCTGGAGGGAGGCCGGAAGG - Intergenic
1183309966 22:37104095-37104117 TGGGCTGGAGGAAGAAAACATGG - Intronic
1183325331 22:37188298-37188320 GGGGATGGAGGGAGAGAGGGCGG + Intronic
1183429120 22:37755211-37755233 GGGGCTGGTGGTGGGCAGCATGG + Intronic
1183429553 22:37757493-37757515 GGGGCTGGAGACAGACCCCAGGG - Intronic
1183603116 22:38851395-38851417 TGGGCTGCAGGGGGGCAGCAGGG + Intergenic
1184177364 22:42795877-42795899 GGGGCTGGGGGGAGACTGAGGGG + Intergenic
1184301242 22:43562508-43562530 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301284 22:43562613-43562635 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301294 22:43562639-43562661 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301317 22:43562692-43562714 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301327 22:43562718-43562740 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301350 22:43562771-43562793 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301360 22:43562797-43562819 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184389595 22:44195636-44195658 GGGGGCGGGGGGAGGCAGCAGGG + Intronic
1184468687 22:44683578-44683600 GGGGCTGGGGGGAGCCAGCCAGG + Intronic
1184647336 22:45903407-45903429 GGGGCTGGGTGGTGACATCATGG + Intergenic
1184656835 22:45946180-45946202 GAGGCTGGAGGGTGAGGGCAGGG - Intronic
1184758705 22:46532914-46532936 GGGGCTGGAGGTGAACAGGAGGG - Intronic
1184792481 22:46708619-46708641 GTGGCTGAAGGGAGAAAGGACGG + Intronic
1184987572 22:48146030-48146052 GAGGCAGGAGGGAGGCAGGAAGG - Intergenic
1184995051 22:48199291-48199313 GGGCCTGGGGGAAGAGAGCAGGG + Intergenic
1185243101 22:49756850-49756872 GAAGGTGGAGGGACACAGCAGGG - Intergenic
1185339311 22:50284465-50284487 GGGGCAGCAGGGAGACCCCAGGG - Intronic
1185382945 22:50518504-50518526 TGGGCTGGGGGGAGACAGCAGGG - Intronic
1203232736 22_KI270731v1_random:125216-125238 GGATGTGGAGGGACACAGCATGG + Intergenic
1203278933 22_KI270734v1_random:112991-113013 GGATGTGGAGGGACACAGCATGG + Intergenic
949473154 3:4417787-4417809 GGGGCTGGAGGGAGCCCACTTGG + Intronic
949477527 3:4462819-4462841 GAGGCAGGAGGGTGACAGAATGG - Intronic
949611911 3:5711497-5711519 GTGGCAGGAGGGGGAGAGCAGGG + Intergenic
950114837 3:10444133-10444155 GGCGCTGGAGTGGGGCAGCAAGG + Intronic
950139876 3:10608101-10608123 GAGTCAGGAGGTAGACAGCAGGG - Intronic
950145219 3:10644731-10644753 GGAGCTGGAGGGAGAAGACATGG + Intronic
950222185 3:11204924-11204946 GGGGCTGGAGGGAGCCTGGTTGG - Intronic
950694257 3:14685667-14685689 GGGACTGGAGGGTGGCAGCGGGG - Intronic
950709296 3:14803536-14803558 GGGGCTGGAAGGACTGAGCAGGG + Intergenic
950841764 3:15974787-15974809 GGGGCTGGAGGGGGGAAGCAGGG - Intergenic
951424509 3:22528207-22528229 GGGGGTGGAGGGTGAGAGGAGGG - Intergenic
951829105 3:26904355-26904377 AGGGATGGAGGGAGAGGGCAAGG + Intergenic
951881514 3:27484593-27484615 GGGGCGGGAGGGAGGCGGGACGG + Intergenic
951923904 3:27886486-27886508 GGGGCAGGAGGGAGGAACCAGGG - Intergenic
951974147 3:28484685-28484707 AGGGAGGGAGGGAGACAGGAAGG - Intronic
952534334 3:34294437-34294459 GGGGGTGGAGGTAGAGGGCAGGG - Intergenic
952820768 3:37483752-37483774 GGAGCTGGGGGGAGACAGGTGGG + Intronic
953154514 3:40356976-40356998 GTTGGTGGAGGGAGGCAGCAGGG - Intergenic
953277768 3:41520211-41520233 GGGGCTGGGGGGAGGGAGAATGG - Intronic
953388880 3:42523129-42523151 AGGGCAGGAGGGAGGTAGCAAGG - Intronic
953571937 3:44078176-44078198 GGGGCTGGAGGGAGGCAGTTAGG - Intergenic
953699898 3:45187425-45187447 GGGTCTGCAGGGAGGCAGGAGGG + Intergenic
953752311 3:45618162-45618184 GTGGTTGGAGGGAGGCAGGAGGG + Intronic
953878325 3:46678955-46678977 GGGTATGGAGGGACACAGCCAGG + Intronic
954683702 3:52359405-52359427 GGGGGTGGAGGGGGACAGACAGG - Intronic
955478700 3:59366913-59366935 AGGGCTGGAGGGAAGTAGCAAGG + Intergenic
955502878 3:59602410-59602432 GGGGCTGGAGGGTGGGAGGAGGG - Intergenic
955799084 3:62667794-62667816 GGGGGTGGGGGGAGACAGGGAGG + Intronic
955808504 3:62761688-62761710 GAGGAGGGAGGGAGAGAGCAAGG + Intronic
956643493 3:71435505-71435527 GGGACTGGAGGGAGGGAGGAAGG + Intronic
956758355 3:72412928-72412950 GGGGCTGGAGGGAACTAGCAAGG + Intronic
957454936 3:80429358-80429380 GAGGGTGGAGGGTGGCAGCAGGG - Intergenic
957538902 3:81542699-81542721 GAGGCAGGAGAGAGAAAGCAGGG + Intronic
957817704 3:85323600-85323622 GGTGCTGGAGGAAGACAGAAGGG - Intronic
959521002 3:107322869-107322891 GGGGTTGTGGGGAGAGAGCAGGG - Intergenic
959747312 3:109791630-109791652 GGTCCTGGAGGAATACAGCAGGG - Intergenic
960256628 3:115517539-115517561 GGAGAAGGAGGAAGACAGCAAGG + Intergenic
960257494 3:115526547-115526569 GAGGGTGGAGGGTGACAGGAGGG - Intergenic
960584821 3:119311045-119311067 GGAGCTGGAGGCAGACAGAGGGG - Intronic
960903829 3:122577873-122577895 GGTGCGGGAAGGGGACAGCAGGG + Intronic
960991462 3:123314319-123314341 GGAGCTGGAAGGAGAGAGGAGGG + Exonic
960998153 3:123352905-123352927 GGGGCAGGAGGGCCACTGCAAGG + Intronic
961049654 3:123735511-123735533 GAAGCTGGAAGGAGCCAGCAGGG - Intronic
961371558 3:126434782-126434804 GGGGCTGGAGGCTGAGGGCAAGG + Intronic
961442045 3:126959034-126959056 GGGGCTGGATGGAGAGAGGATGG - Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961473288 3:127131908-127131930 GGTGCTGGAGAGAGATTGCAGGG - Intergenic
961474933 3:127140543-127140565 GGAGGGGGAGTGAGACAGCAGGG + Intergenic
961637044 3:128340080-128340102 GGGTGGGGAGGGAGACAGCAGGG - Intronic
961637052 3:128340101-128340123 GAGGCAGGAGGGCTACAGCAAGG - Intronic
961645201 3:128389126-128389148 GAGGCTGGAGGGAGGCAGGCAGG + Intronic
961736575 3:129005443-129005465 GGGCCTGGAAGGTGGCAGCAAGG + Intronic
961816786 3:129555258-129555280 GGGGCTGGAGGGGGGCAGCTGGG - Exonic
961825722 3:129598071-129598093 TGGGCTGCGGGGAGCCAGCAGGG - Intronic
962008608 3:131371954-131371976 AGGGCTGGAGGCAGTCTGCAGGG + Intergenic
962629788 3:137264206-137264228 GGGGGTGTGGGGAGACAGCCTGG - Intergenic
962658929 3:137581077-137581099 TGGGGTGGAGGGAGACATAAAGG - Intergenic
962827664 3:139111754-139111776 AGGGCTGAAGGCAGAGAGCAGGG + Intronic
963046164 3:141104232-141104254 TGGGCTGGAGGGAGAGGGCAGGG + Intronic
963757482 3:149250738-149250760 GTGTCTGGAGGGAGGGAGCAAGG + Intergenic
964201274 3:154121577-154121599 GAGGCTGGATGGCGACAGAAGGG + Intronic
964969504 3:162542253-162542275 GGGGATGGAGGCAGACAGAGGGG - Intergenic
967386127 3:188912736-188912758 GGGGCAGGAGGGAGAGAGGGGGG + Intergenic
967780193 3:193429610-193429632 TGGGTTGGAGGGAGAAAGGATGG + Intronic
968649953 4:1756619-1756641 GGGTCAGGAGAGAGAGAGCAGGG - Intergenic
968735759 4:2295850-2295872 GGGGCGTGAGGGAGAGAGGATGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969106076 4:4808011-4808033 GGGGCAGGAGGCAGAGATCACGG + Intergenic
969183276 4:5457902-5457924 AGGGATGGAGGGAGAGAGGAAGG + Intronic
969271805 4:6108157-6108179 AGAGCTGGAGGGACCCAGCAGGG - Intronic
969453098 4:7286108-7286130 GGGGACTGAGGGGGACAGCAAGG - Intronic
969456170 4:7300909-7300931 GAGGCAGGAAGGAGACAGCCGGG - Intronic
969457555 4:7308749-7308771 GGTGCTGGAGCGAGACGACAGGG - Intronic
969530305 4:7726761-7726783 GGGGCTGCAGGGGCACAGCAGGG - Exonic
969662300 4:8537457-8537479 GGGGCTGGAAGCAGGCAGCCTGG - Intergenic
969930674 4:10627916-10627938 GGGGAAAGAGGGAGACAGAAGGG - Intronic
970196017 4:13550250-13550272 GGGGCTTGAGGAGGAGAGCAGGG + Intergenic
970456190 4:16226479-16226501 GAGGCTGGAGGGAGGCGGCGGGG - Exonic
970479304 4:16457674-16457696 GGGGAGGGAGGGAGAGAGGAAGG - Intergenic
970579098 4:17458001-17458023 AGGGCTGGAAGGAAATAGCAAGG + Intergenic
970848725 4:20575605-20575627 GTGCCTGGAAGGAGGCAGCAAGG - Intronic
971013556 4:22464788-22464810 GGGACTGCTGGGAGCCAGCAAGG - Intronic
971063857 4:23004946-23004968 GGAGCAGGAGGAAGACAGAAAGG + Intergenic
971142904 4:23944398-23944420 GAAGCTGGAGGGAGACAAGAAGG - Intergenic
971301923 4:25449000-25449022 GCGCCTGGAGGGAAACAGCTGGG + Intergenic
971358184 4:25913546-25913568 TGGGATGGAGGGAGAGAGGATGG + Intronic
971857349 4:32060244-32060266 GGGGCAGGAAGCATACAGCATGG + Intergenic
972322274 4:37982983-37983005 GGGCCTGGAGCGAGACTGCTGGG + Intronic
972339894 4:38143004-38143026 AGGGCTGGAGAGTGAAAGCAGGG - Intergenic
972370297 4:38417071-38417093 GGAGCAGGAGGAAGACAGCGAGG + Intergenic
973163394 4:47046990-47047012 GAGGCTGGAGGGTGGCAGGAGGG + Intronic
973391932 4:49564301-49564323 GGGTCTGGAGGGTGGTAGCATGG + Intergenic
975697506 4:77028045-77028067 GGGGCTGGAGGGAGATGAGAGGG + Intronic
976503652 4:85820484-85820506 GAGGCTGGAAGGAGGGAGCAGGG + Intronic
977201685 4:94123745-94123767 TGGGATGGAGAGAGACAGAAAGG + Intergenic
977603757 4:98961432-98961454 AAGGCTGGAGGGAAACAGCCTGG + Intergenic
977740575 4:100476197-100476219 AGGGATGGAGGGAGAAAGGAAGG - Intronic
978730082 4:112015299-112015321 GGGGCTGGAGGGCGAGGGGAGGG + Intergenic
978748923 4:112225248-112225270 GGTGCTGCAGGGACACTGCAAGG + Intergenic
979239353 4:118434762-118434784 AGGGAAGGAGGGAAACAGCAGGG + Intergenic
979526347 4:121721420-121721442 AGGGCTGTAGGGAGACAGCAAGG + Intergenic
979821626 4:125180563-125180585 GGGGAGGGAGGGAGAGAGGAAGG + Intergenic
980424997 4:132617440-132617462 GTGGCGGGAGGGAGAGAGCAAGG + Intergenic
981183135 4:141769202-141769224 GGGGGTGGAGGCAGCCACCACGG + Intergenic
982460193 4:155660427-155660449 GGGGAGGGAGGGAGAGAGGAAGG - Intergenic
982813905 4:159861686-159861708 TGGGCAGGAGGGACACAGGATGG - Intergenic
983279886 4:165667035-165667057 AGGGCAGGAGGAAGACAGGAAGG + Intergenic
983330556 4:166322376-166322398 GGGGCTGGAAGCATCCAGCACGG + Intergenic
984194621 4:176643546-176643568 GGGGTAGGAGAAAGACAGCAGGG + Intergenic
984203596 4:176758725-176758747 GGGGCCAGAGGTAGACATCATGG - Intronic
984783477 4:183546796-183546818 GGGGCTGGAGGATGAGAGAATGG - Intergenic
984870677 4:184322332-184322354 GAGGGTGGAGGGAGAGAGGAGGG - Intergenic
984946431 4:184972198-184972220 GGGGCTGGAGGGAGGGAGAGAGG - Intergenic
984947724 4:184983068-184983090 GGGGATGGAGGAAGACAGGGAGG - Intergenic
985370623 4:189282115-189282137 GGGGCAGGAGGCATCCAGCATGG - Intergenic
985417248 4:189749009-189749031 GGGGCTGGGGGAAGGCAGAATGG - Intergenic
985697281 5:1347762-1347784 GGGGATGGAGGGAGAGAGGAGGG + Intergenic
985761334 5:1750731-1750753 TGAGCTGTAGGGAGACATCATGG + Intergenic
985867428 5:2524765-2524787 GTGGCAGGAGGAAGACTGCATGG + Intergenic
986212784 5:5689923-5689945 AGGGCAGGAGGGAGCCTGCAGGG + Intergenic
986285297 5:6354490-6354512 GAGGCTGGAGGGAGACAGGCTGG + Intergenic
986437333 5:7747150-7747172 GGGGTAGCAGGGAGCCAGCATGG - Intronic
986881937 5:12184953-12184975 GGAGCAAGAGAGAGACAGCAGGG + Intergenic
986888319 5:12267833-12267855 GAGGCTGGAGGGTGAGAGGAAGG - Intergenic
986989988 5:13540701-13540723 GTGGCTGGAGGAAGTTAGCAAGG + Intergenic
986999117 5:13641131-13641153 AGAGCAGGAGTGAGACAGCAGGG - Intergenic
987145151 5:14984437-14984459 GAGGCGGCAGGGAGACAGAAAGG - Intergenic
987411681 5:17620996-17621018 GGCGCTGGAGTCAGAGAGCAAGG + Intergenic
988318102 5:29657811-29657833 GAGGGTGGAGGGAGAGAGGAGGG + Intergenic
989063532 5:37434495-37434517 GGTGCTGGGGGAAGACAGTAAGG - Intronic
989542336 5:42632003-42632025 GGGGGTGGAAGGAGAGAGGAGGG - Intronic
990485615 5:56257096-56257118 AGGGAAGGAGGGAGACAGGAAGG - Intergenic
990532769 5:56690068-56690090 GAGGCTGGGGGAGGACAGCAAGG - Intergenic
990670475 5:58123757-58123779 GGGCCTTGACGGACACAGCAAGG + Intergenic
990977364 5:61571584-61571606 GTGGCTGGAGCTAGACAGAAAGG + Intergenic
992001869 5:72443998-72444020 GGTGCTGGAGGAAGCCTGCAAGG - Exonic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992501322 5:77347090-77347112 GGGCATGGAGGAAGACAGGAAGG - Intronic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
993311333 5:86337368-86337390 TGGGCTGAAGGGAGAAAGCTAGG + Intergenic
993969357 5:94397980-94398002 GGGGAGGGAGGGAGAGAGGAAGG - Intronic
995783305 5:115801074-115801096 GGGCCTGGAGGGAGGGAGAATGG - Intergenic
996363366 5:122675035-122675057 GGGGCTGGAGGGAAAGGGGAAGG - Intergenic
999095019 5:148970039-148970061 GGAGTTGGAGGGAGGAAGCAGGG + Intronic
999185304 5:149703086-149703108 GGTGCTGGAGAGAGGCAGCCTGG - Intergenic
999223488 5:150000802-150000824 GGAGCTCGAGGAAGACGGCAGGG - Exonic
999275125 5:150325103-150325125 GGGGAGGGAGGGAGAAAGGAAGG + Intronic
999802099 5:155047906-155047928 GTGGCAGGAGAGAGAGAGCAGGG + Intergenic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
1000035431 5:157444102-157444124 GAGGCAGGAGGGACACAGAAAGG + Intronic
1001067087 5:168544139-168544161 GGAGCTGGAGGAAGACAGGGAGG - Intergenic
1001097693 5:168788489-168788511 GGTTCTGGAGCCAGACAGCATGG + Intronic
1001305713 5:170571122-170571144 GAGGCTGGAGAAGGACAGCAGGG - Intronic
1001657810 5:173366208-173366230 GAGGCTGGAGGGTGAAAGGAGGG - Intergenic
1001734648 5:173988760-173988782 GGGGCTGGAGGGAGAAAGCTGGG - Intronic
1001860211 5:175047767-175047789 GGGGCAGGAGGGTGGCAGGACGG + Intergenic
1002040981 5:176514071-176514093 GGGGCTGGAGAGAGAAAGAAAGG - Intergenic
1002069889 5:176672872-176672894 GGGGCTTCAGGGAGCCAGGAGGG + Intergenic
1002212179 5:177605607-177605629 GGGGATGGTGGGAGTCAGCCCGG - Intronic
1002323585 5:178390320-178390342 CTGGCTGGAGGAGGACAGCAGGG + Intronic
1002401309 5:178992885-178992907 GGGGCTGGAGAGAAACAAGAAGG + Intronic
1002431410 5:179206413-179206435 CGGGCTAGAGGCAGGCAGCAGGG - Intronic
1002564716 5:180104322-180104344 AGGGCTGGAGGGAGCCAGTCTGG + Intronic
1002567171 5:180118701-180118723 GGTGCTGGAAGGAGACAGGGAGG + Exonic
1002698475 5:181105809-181105831 GGGACTGGAGGGAGAGAGGTGGG - Intergenic
1002708425 5:181179107-181179129 GGGACTGGAGGGAGAGAGGTGGG + Intergenic
1002739596 5:181425342-181425364 AGGGAAGGAGGGAAACAGCAGGG + Intergenic
1002772788 6:303844-303866 GGGGCTGGAGGTGGAGAGGAGGG + Intronic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1003033703 6:2624374-2624396 GGGGCGGGAGGGAGAGCGGAAGG + Intronic
1003067637 6:2917315-2917337 GACGCTGGAAGGAGACAACAGGG + Intergenic
1003145782 6:3509275-3509297 AGGGCTGGAGGGAGCAAGCTGGG + Intergenic
1003378134 6:5598031-5598053 GGGGTGGCAGGGAGACAGGATGG - Intronic
1003412233 6:5875951-5875973 GAGGCAGGAGTGAGAGAGCAGGG + Intergenic
1003426175 6:5999685-5999707 GGAGAAGGAGGGAGACAGAAGGG - Intronic
1003563663 6:7204290-7204312 GGGGCGGGGGGAGGACAGCAAGG - Intronic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1003631970 6:7795406-7795428 GGGGATGGAGGAACAAAGCAAGG + Intronic
1004427060 6:15513711-15513733 GGGGCTGGAGTGACAAAGTAGGG - Intronic
1004964677 6:20834880-20834902 GGTGATAGAGGGAGACAGAAAGG - Intronic
1005026559 6:21467910-21467932 GGGGCTGGGGTGAGAGAGAATGG - Intergenic
1005511183 6:26512970-26512992 GGAGCTGGAGGGAAAAAGGAAGG - Intergenic
1005584639 6:27264074-27264096 GGGTCTAGAGTGAGTCAGCAGGG - Intergenic
1006030025 6:31171581-31171603 GGGGGTGGGGGGATATAGCACGG - Intronic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006373461 6:33659196-33659218 GGGGCTGGAGGCAGAGACCATGG - Intronic
1006374352 6:33663637-33663659 TGGGCTGGAGGGAGACAGATGGG + Intronic
1006417512 6:33913384-33913406 TGGGCAGCAGGGAGAGAGCAGGG + Intergenic
1006839814 6:37021574-37021596 GGGGCCTGAGGGAGACATCCAGG + Exonic
1006921829 6:37632618-37632640 TGGGGTGGAGACAGACAGCAAGG + Exonic
1007351443 6:41276448-41276470 GGCACTGGAGGGAGACAGTCGGG + Intronic
1007607239 6:43125856-43125878 GGGGCTGGAATGAGACAGGCTGG - Intronic
1007693200 6:43716114-43716136 GGGGCTGGAGCCAGCCAGCAGGG + Intergenic
1007721757 6:43889372-43889394 GGGGCTGGGGGGTGGCAGGAAGG - Intergenic
1007777814 6:44233559-44233581 GGGGCAGGAGGCAGACAGGGAGG - Exonic
1007928082 6:45665994-45666016 GGTGGTGGAGAGAGGCAGCAGGG + Intergenic
1007959232 6:45943419-45943441 GTGGCTGGGGGCACACAGCAGGG + Intronic
1007996723 6:46315620-46315642 GGGCCTTGAGGGCCACAGCAAGG + Intronic
1009428618 6:63541703-63541725 GGAGTTGGATGGAGACAGTAGGG - Intronic
1009905861 6:69868572-69868594 GGGAAAGGAGGGAGACAGTATGG + Intronic
1010329673 6:74608531-74608553 GAGGCTGGAGGGTGAGAGGAGGG - Intergenic
1011014773 6:82742845-82742867 GGGGCTGGTTGGAGTCAGGAGGG - Intergenic
1011041516 6:83034653-83034675 GGGGCAGGAGAGAGAGAGCAGGG - Intronic
1011119940 6:83941623-83941645 GAGGATGATGGGAGACAGCAGGG - Intronic
1011259078 6:85453189-85453211 GAGGCACGAGGAAGACAGCATGG + Intronic
1012078175 6:94721655-94721677 GGTGCTGGGGTGAGGCAGCATGG - Intergenic
1012448313 6:99328791-99328813 AAGGCTGGAGGCAGACATCAAGG - Intronic
1012866399 6:104623298-104623320 GGGCAGGGAGGGAGAGAGCAAGG + Intergenic
1012971074 6:105731814-105731836 GGGGTGGGAGGGAGACTGCTGGG - Intergenic
1013056830 6:106591021-106591043 CCAGCTGGAGGGATACAGCAGGG + Intronic
1013170494 6:107633927-107633949 GTGGCTGGACGGAGACAGGAGGG - Exonic
1013225474 6:108117283-108117305 AGGACTAGAGGGAGACAGCCTGG - Intronic
1013516730 6:110894270-110894292 GGGTCTTGGGGGAGACACCAGGG - Exonic
1013740952 6:113283929-113283951 GGGGATGGAGGGTGACGGGAGGG + Intergenic
1013961735 6:115909030-115909052 GCAGCTGGAGAGAGACAGGAAGG + Intergenic
1014355087 6:120398539-120398561 GGGGATGGAGGGAGAGGGGAAGG + Intergenic
1015318247 6:131842006-131842028 GGGGCTGGAGGGAAAAGGGAGGG - Intronic
1015499952 6:133921413-133921435 GGCGCTGGAGGGACACTGTAAGG - Intergenic
1015671857 6:135699769-135699791 GCGGGTGGAGGCAGACAGCCAGG + Intergenic
1016654702 6:146505145-146505167 GGGGATGGAGGGGAAGAGCAAGG - Intergenic
1017090712 6:150756239-150756261 GGAGCTGGAGGGTGTCTGCAAGG - Intronic
1017381141 6:153831573-153831595 GGTGCTGGAGGGAGACAGAGAGG + Intergenic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1017421547 6:154278003-154278025 AGGGCAGGAGGGAGAGAGGAAGG - Intronic
1017503387 6:155045955-155045977 GGGGCGGGCGGGAGGTAGCAGGG + Intronic
1018029119 6:159828142-159828164 GGAGCAGGAGGAAGACAGAAGGG + Intergenic
1018767264 6:166944455-166944477 GGGGCTGGAGGGGAAGAGGAGGG - Intronic
1018781939 6:167076169-167076191 GGGGAGGGAGGGAGAGAGGAAGG - Intergenic
1018781953 6:167076212-167076234 GGGGAGGGAGGGAGAGAGGATGG - Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019005284 6:168791259-168791281 GAGGCTGGAGCGAGAGAGCATGG + Intergenic
1019129175 6:169860810-169860832 GTGGCAGGAGAGAGACAGCAGGG - Intergenic
1019149489 6:169994535-169994557 GCGTCTGCAGGGAGCCAGCAGGG - Intergenic
1019187725 6:170230593-170230615 GGGGCTGGAGGGACCCAGGCGGG + Intergenic
1019244712 6:170700929-170700951 AGGGAAGGAGGGAAACAGCAGGG + Intergenic
1019345085 7:525730-525752 GGGGCTGGAGGAGGACAGGGAGG + Intergenic
1019357137 7:586491-586513 AGGGCTGGAGGGTGGCAGGAAGG - Intronic
1019414194 7:919903-919925 GGGGAGGGAGGGAGAGAGCCAGG + Intronic
1019507007 7:1396503-1396525 GGGGCATGAGGGAGCCTGCAGGG + Intergenic
1019552352 7:1609309-1609331 GGGGCAGTGGGGAGACAGCTTGG + Intergenic
1019588832 7:1818867-1818889 GGGGGTGGACGGAGACAGGCAGG + Intronic
1019631367 7:2051619-2051641 GGGGGAGGTGGGGGACAGCAAGG - Intronic
1019774964 7:2906860-2906882 GGGGCTGTGGGGAGGCTGCAAGG + Intronic
1019938672 7:4272375-4272397 TGGGCTCGAGGGTGACTGCAGGG + Intergenic
1020116379 7:5478631-5478653 GGGGTTGGAGGGAGGGAGGAGGG - Intronic
1020643185 7:10780471-10780493 GGGACAGAAGGCAGACAGCAAGG + Intergenic
1021315998 7:19147692-19147714 GGGGAGGGAGGGAGAGAGGAAGG - Intergenic
1021608644 7:22434303-22434325 GGAGTTGGCGGGAGACAGCATGG - Intronic
1022044752 7:26613876-26613898 GGGCCTGGAGGGTCACAACAGGG + Intergenic
1022091473 7:27110467-27110489 GGCGCTGGAGGGAGACTGGAGGG + Exonic
1022319947 7:29278935-29278957 AGGCCTGGGGGGAGGCAGCAAGG - Intronic
1022407355 7:30103102-30103124 GGTGCTGGAGGGAGGAAGAATGG + Intronic
1022649719 7:32263309-32263331 GGGGGAGGAGGGAGAAGGCAAGG - Intronic
1023170489 7:37386270-37386292 AGGGCTGGAGGGAGGAATCAAGG + Intronic
1023262301 7:38370297-38370319 GGCCCTGGAGGGAGACACAATGG - Intergenic
1023268998 7:38439097-38439119 GTGGCAGGAGAGAGACAGCAGGG - Intronic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024280997 7:47719790-47719812 GGGGCTAGAGGGACGCAGAATGG + Intronic
1024432181 7:49301758-49301780 GGGGCTGGTGAGTGACATCAGGG + Intergenic
1024682467 7:51707392-51707414 GGGGCTGGAGGGAAAGGGGAGGG - Intergenic
1024947942 7:54830478-54830500 GGGGCTGGAGGGAGAGGAGAAGG + Intergenic
1024996792 7:55278429-55278451 GGGTCTGCATGGAGACAGCCTGG - Intergenic
1025019182 7:55467315-55467337 GGGGCAGGAGGGAGTCAGGCAGG + Intronic
1025036524 7:55596520-55596542 GGGGCTGGAGGGAGAAGAAAAGG - Intergenic
1025201247 7:56963122-56963144 GGGGTTGGAGGGAGTGAGAAAGG + Intergenic
1025670697 7:63613811-63613833 GGGGTTGGAGGGAGCGAGAAAGG - Intergenic
1026312557 7:69199790-69199812 TGGGCTAGAGGGAGACTGCACGG - Intergenic
1026535197 7:71233303-71233325 GGTGTTGGAGGGAGAGAGGATGG + Intronic
1026804895 7:73423660-73423682 GGGACTGAAGGGAGACAGTAGGG + Intergenic
1026861797 7:73795136-73795158 GGGGTTGGAGAGACAGAGCAAGG - Intergenic
1027130452 7:75586691-75586713 GGGGCTGAAGGGATGGAGCAGGG + Intronic
1027229656 7:76264844-76264866 GGGGCGGGAGGGAGAACGAATGG - Intronic
1027356167 7:77357732-77357754 GAGGCTGGAGGGAGGACGCAAGG + Intronic
1027543173 7:79493609-79493631 GGGGATGGAGAGAGAGAGAAGGG - Intergenic
1027820973 7:83044129-83044151 GTGGCAGGGGAGAGACAGCAAGG + Intronic
1028603494 7:92629055-92629077 AGGGCTGGTGGGAAAGAGCACGG + Intronic
1028964970 7:96791913-96791935 GGGGTTGGAGGATGGCAGCATGG + Intergenic
1029172624 7:98641662-98641684 AGGGAGGGAGGGAGACAGCGAGG - Intergenic
1029654607 7:101915956-101915978 GGGGCTGGAGGGTGGCGGGAAGG - Intronic
1029787496 7:102807187-102807209 GGGGTCGGAGGGTGACAGGAAGG + Intronic
1030085426 7:105811645-105811667 GGGGCTGGATGAGGGCAGCAAGG + Intronic
1030304219 7:108002882-108002904 GTGGCTGCAGGGAGCCGGCATGG - Exonic
1030820183 7:114084983-114085005 GGGACCGGAGGGAGACGGCGGGG + Intergenic
1031523300 7:122793151-122793173 GGGGCTGGAGGGATGCACCAAGG - Intronic
1031808471 7:126336428-126336450 GAGGCTGGAGGAAGACAAAATGG - Intergenic
1031894764 7:127336433-127336455 GAGGCTGGAGGGAGAAACCAAGG - Intergenic
1032003905 7:128284975-128284997 GGGGCTGGAGGGAGGAGGAAAGG + Intergenic
1032366621 7:131306083-131306105 GTGGCAGGAGGGAGAGAGCAAGG - Intronic
1032384457 7:131511867-131511889 GGGGCTGGACGGGGAGGGCAGGG - Intronic
1032386862 7:131531164-131531186 TGGGCTGGAGGGATCCAGAAGGG - Intronic
1032442152 7:131950139-131950161 AGCGCTGCAGTGAGACAGCAAGG - Intergenic
1032717991 7:134527322-134527344 AGGTAGGGAGGGAGACAGCAAGG - Intergenic
1033150856 7:138913937-138913959 GAGGGAGGAGGGAGACAGGAAGG + Intronic
1033400613 7:141020310-141020332 GGGGGTGGAGGGAGGGAGGAAGG + Intergenic
1033537042 7:142321636-142321658 GGGACTGCAGGGAGAAAGAAAGG + Intergenic
1034266417 7:149783249-149783271 GGTGGTGCAGGGAGACAGCAGGG - Intergenic
1034291136 7:149932726-149932748 GGGGAGGGAAGGGGACAGCAGGG + Intergenic
1034359313 7:150480165-150480187 GGGACTGGCTGGAGAAAGCATGG + Intergenic
1034849514 7:154480631-154480653 AAGACTGGAGGGAGACACCAAGG - Intronic
1035096706 7:156361740-156361762 GGGTCTCGAAGGAAACAGCAAGG + Intergenic
1035206350 7:157296092-157296114 GGGGTTGGAAGAAGACAGCGTGG - Intergenic
1035266285 7:157691879-157691901 GGGCCTGGGGAGAGAGAGCATGG - Intronic
1035297598 7:157875981-157876003 GGGGCTGCAGAGGGTCAGCAGGG + Intronic
1035318882 7:158015509-158015531 GGGGTGGGAGGAAGACAGAAAGG + Intronic
1035503414 8:107259-107281 AGGGAAGGAGGGAAACAGCAGGG - Intergenic
1035537826 8:406276-406298 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1036285859 8:7443639-7443661 AGGGCTGCAGGGAGAGAGAAGGG - Intronic
1036335614 8:7867890-7867912 AGGGCTGCAGGGAGAGAGAAGGG + Intronic
1036507911 8:9372506-9372528 GGAGCTGGAGGGAGAGTGCCAGG - Intergenic
1036963754 8:13273741-13273763 GGGGAGGGAGGGAGACAGGGAGG + Intronic
1037033929 8:14142835-14142857 GGGGCAGGAGGAAGAGAGCAAGG - Intronic
1037336751 8:17800229-17800251 GGGGCTGGAGGGTGGGAGTAGGG - Intronic
1037880267 8:22570225-22570247 GTGGCTGGATGGAGACAGATGGG + Intronic
1037889138 8:22614073-22614095 GGGGCTACAGGAAGACAGCAAGG - Exonic
1038419921 8:27427312-27427334 GGGGCTGGAGGGATTCAGGATGG - Intronic
1038570562 8:28658518-28658540 GGGGCAGGGGGGGAACAGCAAGG - Intronic
1039085894 8:33779157-33779179 GGGGATGGAGGCAGACAGAGAGG - Intergenic
1039265813 8:35822781-35822803 GAGGGTGGAGGGTGACAGGAGGG + Intergenic
1040091146 8:43400304-43400326 GTGGCAGGAGGTAGATAGCAAGG + Intergenic
1040610323 8:48977089-48977111 GGGGGTGGAGTGAGCCAGAAGGG + Intergenic
1040967949 8:53102656-53102678 TAGGTGGGAGGGAGACAGCAAGG + Intergenic
1041180625 8:55244209-55244231 GAGGCTGGAGGGTGAGAGGAGGG - Intronic
1041181989 8:55258796-55258818 GGGGCTTGGAGGGGACAGCAAGG - Intronic
1041289227 8:56293040-56293062 AGGGCTGGAGAGAGTGAGCAGGG + Intergenic
1041552540 8:59118479-59118501 GGGGAGGGAGGGAGAGAGAAGGG + Intronic
1041711798 8:60901133-60901155 TGGGAGGGAGGAAGACAGCATGG - Intergenic
1041786500 8:61639913-61639935 GTAGCTGGGGGGAGACAACAAGG - Intronic
1042156422 8:65849278-65849300 CGGGCTGGAGTGCAACAGCATGG + Intergenic
1042217250 8:66438885-66438907 GGGGGTGTAGGGAGGAAGCAAGG + Intronic
1042476195 8:69250675-69250697 GGAGCAGGAGAGAGAAAGCAAGG - Intergenic
1042715245 8:71765382-71765404 GGGGCAGGAAGGAGAGAGGAAGG - Intergenic
1042758143 8:72241205-72241227 AGGGAGGGAGGGAGACAGGAAGG + Intergenic
1042871661 8:73405447-73405469 GGGCCTGGCTGGAGGCAGCATGG - Intergenic
1043779295 8:84312114-84312136 GTGGCAGGAGAGAGATAGCAAGG + Intronic
1043818552 8:84834567-84834589 GGTGCTGGAGGAAAACTGCAAGG - Intronic
1044396357 8:91717526-91717548 GGAGCTGGAGGGAGGAAGGAAGG + Intergenic
1044465255 8:92495621-92495643 GGGGCTGGAGGAACCAAGCACGG - Intergenic
1044499520 8:92936474-92936496 GAGGCAGGAAGGAGAAAGCAAGG + Intronic
1044785292 8:95786948-95786970 AGGGCAGGAGGGACAGAGCAGGG - Intergenic
1045469856 8:102502585-102502607 GGGGTTGGAGGGAGGCAAAAGGG - Intergenic
1045544011 8:103112068-103112090 GAGGCTGGGGGGACAGAGCAAGG + Intergenic
1045611822 8:103852548-103852570 GAGGCGGGAGGGAGAGAGCGAGG - Intronic
1047203697 8:122786706-122786728 GGGGGTGGGGGGAGGCAGAAGGG - Intronic
1047403969 8:124569534-124569556 GGGACAGCAGGGTGACAGCAGGG + Intronic
1048031927 8:130641195-130641217 GTGGCAAGAGGGAGTCAGCAGGG + Intergenic
1048336085 8:133503512-133503534 GGGGCTGGACGGAGGGAGGAAGG - Intronic
1048856813 8:138693490-138693512 GTGGTTGGTGGGAGTCAGCACGG - Intronic
1048959360 8:139563130-139563152 AGGGATGGAGGGAGGCAGCCAGG - Intergenic
1049224556 8:141443722-141443744 GGGGCTGGATGGAGGGAGAATGG - Intergenic
1049428693 8:142549377-142549399 GGGCCTGGAGGGGGAGGGCAGGG + Intergenic
1049428701 8:142549397-142549419 GGGCCTGGAGGGGGAGTGCAGGG + Intergenic
1049447366 8:142637431-142637453 TGAGCTGGAGGGAGACAGTGAGG + Intergenic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1049544859 8:143225861-143225883 GGTGGTGGTAGGAGACAGCATGG + Intergenic
1049739042 8:144226515-144226537 GAGGCTGCAGTGAGCCAGCATGG - Intronic
1049756048 8:144311782-144311804 GGGGCTGGCAGGAGCCAGCTCGG - Exonic
1049801949 8:144521979-144522001 CGGGCTGGAGGGGGTCATCAAGG + Exonic
1051639704 9:19213212-19213234 GGTAGTGGAGGGAGACAACAGGG + Intergenic
1052414532 9:28160553-28160575 GGGGCAGGAGGGGAACAGAAAGG - Intronic
1052854913 9:33401202-33401224 GGGGCTGGAGGGTGAGAAGAGGG + Intronic
1053014716 9:34655270-34655292 GGGGGAGGAGGCAGACACCAGGG - Exonic
1053019477 9:34684986-34685008 AGGGTTGGAGGAAAACAGCAAGG - Intergenic
1053175204 9:35917569-35917591 AGCAGTGGAGGGAGACAGCAGGG + Intergenic
1053269511 9:36740389-36740411 GGGCCTGGAGGGAGGGGGCATGG - Intergenic
1053645086 9:40115458-40115480 GGAGGAGGAGGGAGACAGAATGG + Intergenic
1053682935 9:40497531-40497553 GGGGCTGGAGGGTGAGAAGAGGG + Intergenic
1053760632 9:41348070-41348092 GGAGGAGGAGGGAGACAGAATGG - Intergenic
1053932916 9:43125845-43125867 GGGGCTGGAGGGTGAGAAGAGGG + Intergenic
1054280779 9:63127397-63127419 GGGGCTGGAGGGTGAGAAGAGGG - Intergenic
1054296034 9:63333031-63333053 GGGGCTGGAGGGTGAGAAGAAGG + Intergenic
1054326110 9:63713356-63713378 GGAGGAGGAGGGAGACAGAAGGG + Intergenic
1054394051 9:64637526-64637548 GGGGCTGGAGGGTGAGAAGAGGG + Intergenic
1054501679 9:65878804-65878826 GGGGCTGGAGGGTGAGAAGAGGG - Intronic
1054539487 9:66260513-66260535 GGAGGAGGAGGGAGACAGAATGG - Intergenic
1055914541 9:81387371-81387393 AGGGAAGGAGGGAGAGAGCAAGG + Intergenic
1056189598 9:84171993-84172015 GGGACAGGAGGAAGACATCAAGG - Intergenic
1056513773 9:87330751-87330773 GGGGCAGGCGGGAGCCAGAAAGG + Intergenic
1056523952 9:87425406-87425428 GGGGAAGGAGGGAGACAGGAAGG + Intergenic
1056687602 9:88779285-88779307 AGGGCTGGAGGGAGCAAGCCTGG - Intergenic
1056824570 9:89867916-89867938 GGGACTGGTGGGAGCCAGCCTGG + Intergenic
1056967802 9:91179136-91179158 GGGGCTGCAGGGAGTCATCAGGG + Intergenic
1057176602 9:93004776-93004798 CGGGCTGGTGGGACACAGAAGGG - Intronic
1057219248 9:93247219-93247241 GGGGCTGGTGGCAGACGGGAAGG - Intronic
1057304572 9:93904750-93904772 GGGGATGCAGGAGGACAGCAGGG + Intergenic
1057495193 9:95554927-95554949 AGGGCTGGAGGGAGCTAGCTAGG + Intergenic
1057858638 9:98622678-98622700 GGGGCTGGGGGGGCACTGCAAGG - Intronic
1058108911 9:101008044-101008066 GAGGCTGGAGAGTGACAGGAGGG + Intergenic
1058755710 9:108081294-108081316 GGCTCTGGAGGCAGACAGCCTGG - Intergenic
1059370970 9:113835152-113835174 GGGGCTGCAGGGAGAGGGAATGG + Intergenic
1059441189 9:114307805-114307827 GGGGATAGAGGCAGACAGCCTGG - Intronic
1059681741 9:116592353-116592375 GGAGCAGGAGGGAGAGAGAAGGG + Intronic
1059829445 9:118077868-118077890 GAGGCTGAAGGGTGAGAGCAGGG - Intergenic
1060146754 9:121259614-121259636 GAGGCTGGAGGGTTAAAGCAAGG + Intronic
1060182853 9:121546036-121546058 GGGGGTGGAGAGGGCCAGCAGGG - Intergenic
1060187227 9:121571047-121571069 GGCCCTGGGGGGAGACAGCTTGG - Intronic
1060553988 9:124499043-124499065 GGGGCTGGGTGTAAACAGCAGGG - Intronic
1060985857 9:127818596-127818618 GAGTCAGGAGGGAGACAGCCTGG - Intronic
1061066372 9:128280281-128280303 AGGGCTGGAGAGAGATAGGAGGG - Intronic
1061627303 9:131848610-131848632 GGGGTAAGAGGGAGACAGAAGGG + Intergenic
1061701923 9:132422624-132422646 GGGGCTGCAGTGAAGCAGCAGGG + Intronic
1061788013 9:133042419-133042441 GGGGCTGTGGGGACACAGCAGGG + Intronic
1062183483 9:135203579-135203601 GGGGCTGGGGAAAGACAGCAGGG - Intergenic
1062261651 9:135665934-135665956 GGGGCTGGATGGGGAGAGCTTGG + Intronic
1062331089 9:136045245-136045267 GGGGGTGGAGGGAGCCAGAAGGG + Intronic
1062367513 9:136218310-136218332 GGGGCTGGGGGGAGAGAGAGAGG - Intronic
1062443935 9:136585535-136585557 GTGGCTGGAGGGCGAGGGCAGGG + Intergenic
1062473808 9:136717967-136717989 GGGGCTGGGGGCAGAAGGCAGGG + Intronic
1062598972 9:137311653-137311675 GGGCCTTGTGGGTGACAGCAAGG - Intronic
1062680741 9:137778559-137778581 GAGGCTGGAGGCAGACAGAGGGG - Intronic
1202792888 9_KI270719v1_random:98913-98935 GGAGGAGGAGGGAGACAGAAGGG + Intergenic
1203604902 Un_KI270748v1:50149-50171 AGGGAAGGAGGGAAACAGCAGGG + Intergenic
1203635890 Un_KI270750v1:110639-110661 GGGGCTGGGGGAAGGCAGAATGG + Intergenic
1185505055 X:627161-627183 GCGGCTGCAGGCAGAAAGCAGGG - Intronic
1185819854 X:3191972-3191994 TGGGCTGGTGGGGGCCAGCATGG + Intergenic
1185932753 X:4221246-4221268 AGGGCTGGAGGGAGAGTGTATGG - Intergenic
1186060371 X:5698989-5699011 AAAGCTGGAGGGAGACTGCAGGG - Intergenic
1186496241 X:10014897-10014919 GGAGCGGGAGGGAGAGAGCGAGG + Intergenic
1186990484 X:15061786-15061808 AGGGCTGGAGGGAGAAGCCAAGG - Intergenic
1187118867 X:16384022-16384044 GGGGCTGGAGGAACACTGTAGGG - Intergenic
1187447160 X:19370079-19370101 TGGGCTGGAGCCAAACAGCAAGG + Intronic
1187464996 X:19519203-19519225 GGGGCTGGGGGGAGGTAGGAAGG - Intergenic
1187878330 X:23823050-23823072 GGGTTGGGAGGGAGAAAGCATGG - Intergenic
1187924950 X:24241191-24241213 GGGGCTGGGGAGAGAAAGAATGG + Intergenic
1188002972 X:24999303-24999325 GGGGCGGGAGAGAGACAGTGAGG - Intergenic
1188585393 X:31768321-31768343 AGGGATGGTGGGAGACAGGAGGG - Intronic
1189240315 X:39519698-39519720 GGGGAGGGAGGGAGGCAGCGTGG - Intergenic
1189283552 X:39836197-39836219 GGGAGAGGAGGGAGAGAGCAAGG - Intergenic
1189288104 X:39866435-39866457 GGAGGTGGAGGGAGAGAGGAAGG + Intergenic
1189352592 X:40287404-40287426 GGGGCTGGGGGGTGAGAGGAGGG - Intergenic
1189381699 X:40506858-40506880 GGGGGTGGAGGGAGAAAAGAAGG + Intergenic
1189567904 X:42262312-42262334 TGGGGTGAAGGCAGACAGCAGGG + Intergenic
1189700531 X:43713973-43713995 GGGGCAGGAGAAAGACAGGAAGG + Intronic
1189700838 X:43715450-43715472 GGGTCAGGGGTGAGACAGCAAGG + Intronic
1189736955 X:44081021-44081043 GGGGGTGGAGGGTGAGAGGAGGG - Intergenic
1190179278 X:48177675-48177697 GGGGCTGGAAGGAAACAGGGTGG + Intergenic
1190340289 X:49290682-49290704 GGGGCTGGAGCGACACAGTTTGG + Intronic
1190516266 X:51226385-51226407 GGCTCTGGAGGGAGACTGCCTGG + Intergenic
1190652671 X:52582474-52582496 GGGACAGAAGGCAGACAGCAAGG - Intergenic
1190713743 X:53087561-53087583 GGAGATGGAGGGAGGCAGGAAGG - Intronic
1191000872 X:55658472-55658494 GGGACAGAAGGCAGACAGCAAGG + Intergenic
1191822826 X:65331475-65331497 GAGGCTAGAGGTAGACAGAATGG + Intergenic
1192075783 X:67994712-67994734 GAGGGTGGAGGGAGGCAGGAGGG - Intergenic
1192189645 X:68983125-68983147 GGAGCTGGAGCAGGACAGCAGGG + Intergenic
1192261363 X:69507405-69507427 GAGGCGGGAGGGAGACTGCTAGG - Intronic
1192381957 X:70626347-70626369 GGGGAGGGAGGGAGACACCTAGG - Intronic
1192424468 X:71062853-71062875 TGAGCTGGAGAGAGATAGCAAGG - Exonic
1194234434 X:91364704-91364726 GAGGGTGGAGGGAGGGAGCAGGG + Intergenic
1194338054 X:92673676-92673698 GAGGGTGGAGGAAGAAAGCAAGG + Intergenic
1194878870 X:99225333-99225355 GAGGGTGGAGGGAGAAAGGAGGG - Intergenic
1195080937 X:101369800-101369822 AGGGGAGGAGGGAGACAGGAAGG - Intronic
1195293438 X:103451386-103451408 GAAGCTGGAGGGAGACAGGTAGG - Intergenic
1197287443 X:124612737-124612759 AGGGAGGGAGGGAGAAAGCAAGG - Intronic
1197708562 X:129650742-129650764 GGGGCTGGAGAGGGAAAGGAAGG + Intronic
1197783240 X:130177075-130177097 GAGGATGGAGGGGCACAGCATGG - Intronic
1197982168 X:132228513-132228535 GGAGGTGGGGGGCGACAGCAGGG - Intergenic
1198339073 X:135696498-135696520 GGGGATGGAGGGTGAGAGGAGGG - Intergenic
1198370225 X:135982813-135982835 GTGGCTGGGGGGAGAAAGAAAGG + Intergenic
1199074171 X:143510844-143510866 GGGGATGGAGGGTGACAGTAAGG - Intronic
1199093165 X:143714105-143714127 GGGGATGGAGGGCGACAGTAAGG - Intronic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1199215170 X:145254055-145254077 GGGGATGGAGGGTGACAGTAAGG + Intronic
1199899026 X:152154872-152154894 TGGGCTGGAGGGAAAAAACAGGG - Intergenic
1200214276 X:154360548-154360570 GGGGCTGCAGGGAGGCAGTGCGG - Exonic
1200646457 Y:5790411-5790433 GAGGATGGAGGAAGAAAGCAAGG + Intergenic
1200764303 Y:7067391-7067413 GAGGCTGGAGTGAGCCATCAAGG + Intronic
1201342197 Y:12946737-12946759 GGGGCAGGATGGTGACAGCATGG + Intergenic
1201565590 Y:15362318-15362340 GGGGCTTGTGGGAGCCCGCATGG - Intergenic
1202387087 Y:24336545-24336567 AGGGAAGGAGGGAAACAGCAGGG + Intergenic
1202483699 Y:25333583-25333605 AGGGAAGGAGGGAAACAGCAGGG - Intergenic