ID: 1131658835

View in Genome Browser
Species Human (GRCh38)
Location 15:94492250-94492272
Sequence ATAGTTTACCAAATATGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131658835_1131658840 20 Left 1131658835 15:94492250-94492272 CCCACACATATTTGGTAAACTAT No data
Right 1131658840 15:94492293-94492315 GTAACACATTTGCAGTGTAAGGG No data
1131658835_1131658837 -2 Left 1131658835 15:94492250-94492272 CCCACACATATTTGGTAAACTAT No data
Right 1131658837 15:94492271-94492293 ATAACCTTAATTCATATCAAAGG No data
1131658835_1131658839 19 Left 1131658835 15:94492250-94492272 CCCACACATATTTGGTAAACTAT No data
Right 1131658839 15:94492292-94492314 GGTAACACATTTGCAGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131658835 Original CRISPR ATAGTTTACCAAATATGTGT GGG (reversed) Intergenic
No off target data available for this crispr