ID: 1131659335

View in Genome Browser
Species Human (GRCh38)
Location 15:94497489-94497511
Sequence GACCTGGATTTCCGAACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131659335_1131659337 -9 Left 1131659335 15:94497489-94497511 CCAGTAGTTCGGAAATCCAGGTC No data
Right 1131659337 15:94497503-94497525 ATCCAGGTCATCCCTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131659335 Original CRISPR GACCTGGATTTCCGAACTAC TGG (reversed) Intergenic
No off target data available for this crispr